Incidental Mutation 'R0792:Olfr203'
ID82482
Institutional Source Beutler Lab
Gene Symbol Olfr203
Ensembl Gene ENSMUSG00000068182
Gene Nameolfactory receptor 203
SynonymsMOR182-5, GA_x54KRFPKG5P-55517445-55518365
MMRRC Submission 038972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0792 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59298881-59304413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59303989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 280 (I280F)
Ref Sequence ENSEMBL: ENSMUSP00000086719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000201687] [ENSMUST00000215893]
Predicted Effect probably damaging
Transcript: ENSMUST00000089305
AA Change: I280F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: I280F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-46 PFAM
Pfam:7tm_1 41 290 7.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201687
AA Change: I279F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144622
Gene: ENSMUSG00000048810
AA Change: I279F

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.4e-46 PFAM
Pfam:7tm_1 40 289 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215893
AA Change: I279F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,933,868 probably null Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ahnak G T 19: 9,016,734 M5127I probably benign Het
Akr1c13 T C 13: 4,194,112 Y55H probably damaging Het
Ap3d1 A T 10: 80,708,479 H1161Q probably benign Het
Atp2b2 C T 6: 113,773,388 R625H probably damaging Het
Bdnf G A 2: 109,724,118 C239Y probably damaging Het
Bpifa5 G T 2: 154,165,619 probably null Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Cep68 A T 11: 20,240,652 L120H possibly damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Cpne1 G T 2: 156,077,419 Q343K probably benign Het
D3Ertd254e A G 3: 36,164,562 M244V probably benign Het
Dlc1 A T 8: 36,938,548 I29K probably benign Het
Dnah9 T C 11: 65,896,001 D3602G possibly damaging Het
Dock1 A G 7: 134,874,150 S885G probably benign Het
Evpl T A 11: 116,227,723 Q686L probably damaging Het
Fmo6 C T 1: 162,920,563 A311T probably damaging Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Grin2c G A 11: 115,250,646 P882L probably damaging Het
H2-Ob C T 17: 34,242,614 T109I probably damaging Het
Jpt2 C A 17: 24,948,673 A101S probably benign Het
Krt2 A G 15: 101,816,497 V226A probably damaging Het
Lamc1 C A 1: 153,234,580 Q1116H possibly damaging Het
Lamc1 T G 1: 153,234,595 Q1111H probably damaging Het
Lamc1 T C 1: 153,234,612 S1106G probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Ltbp4 G T 7: 27,325,060 P715Q probably damaging Het
Mtor T C 4: 148,462,910 V450A probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myom1 A T 17: 71,121,136 I1450F probably damaging Het
Naip6 A G 13: 100,283,766 I1332T possibly damaging Het
Ncstn A G 1: 172,071,505 V353A possibly damaging Het
Nt5c3 T C 6: 56,886,749 T149A probably benign Het
Olfr510 A G 7: 108,668,157 H247R probably damaging Het
Paip1 T C 13: 119,430,318 S54P possibly damaging Het
Prdm14 G T 1: 13,125,744 A31E probably benign Het
Prr14l A G 5: 32,828,423 S1243P probably damaging Het
Prss1 T C 6: 41,458,944 M1T probably null Het
Raver2 T A 4: 101,102,950 V209D probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Slc16a13 A T 11: 70,220,631 V16E probably damaging Het
Slc30a6 T C 17: 74,415,645 S236P possibly damaging Het
Sobp A C 10: 43,022,693 S299A probably damaging Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Trak2 A T 1: 58,903,661 M862K probably benign Het
Ubox5 A T 2: 130,600,710 V19E probably damaging Het
Vmn1r173 A G 7: 23,702,735 T132A probably benign Het
Zfp820 T C 17: 21,819,528 D273G probably benign Het
Other mutations in Olfr203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Olfr203 APN 16 59303633 missense probably damaging 0.99
IGL02294:Olfr203 APN 16 59303612 missense probably damaging 1.00
IGL02412:Olfr203 APN 16 59303192 missense probably damaging 1.00
IGL02899:Olfr203 APN 16 59303286 missense probably damaging 1.00
R1551:Olfr203 UTSW 16 59303403 missense probably benign 0.03
R1701:Olfr203 UTSW 16 59303288 missense probably benign 0.23
R1975:Olfr203 UTSW 16 59303728 missense probably damaging 0.98
R2272:Olfr203 UTSW 16 59303444 missense possibly damaging 0.55
R5199:Olfr203 UTSW 16 59303740 missense probably benign
R5843:Olfr203 UTSW 16 59303361 missense probably damaging 1.00
R5928:Olfr203 UTSW 16 59303158 missense probably damaging 1.00
R6708:Olfr203 UTSW 16 59304053 missense probably damaging 1.00
R6747:Olfr203 UTSW 16 59303641 missense probably benign 0.03
R6894:Olfr203 UTSW 16 59303779 missense probably damaging 0.98
R7324:Olfr203 UTSW 16 59303248 missense probably benign
R7380:Olfr203 UTSW 16 59304028 missense probably damaging 1.00
R7612:Olfr203 UTSW 16 59303627 missense probably damaging 1.00
R7775:Olfr203 UTSW 16 59303251 missense probably damaging 1.00
R8010:Olfr203 UTSW 16 59303504 missense probably damaging 1.00
Z1176:Olfr203 UTSW 16 59303169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGAAAACAAAGTCTGAGAGGGGC -3'
(R):5'- GTGAGCAATGTGCAGTTATCACATGAAG -3'

Sequencing Primer
(F):5'- GGCAGAAGAAAAGCCTTCTCC -3'
(R):5'- CACTAGAGTTTGTGTTACAAAGAGAC -3'
Posted On2013-11-08