Incidental Mutation 'R0792:Armh3'
ID 82490
Institutional Source Beutler Lab
Gene Symbol Armh3
Ensembl Gene ENSMUSG00000039901
Gene Name armadillo-like helical domain containing 3
Synonyms 9130011E15Rik
MMRRC Submission 038972-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0792 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 45805803-45986927 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 45922307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396]
AlphaFold Q6PD19
Predicted Effect probably null
Transcript: ENSMUST00000045396
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,268,924 (GRCm39) V195A probably benign Het
Adgrb1 A G 15: 74,452,466 (GRCm39) M211V probably damaging Het
Ahnak G T 19: 8,994,098 (GRCm39) M5127I probably benign Het
Akr1c13 T C 13: 4,244,111 (GRCm39) Y55H probably damaging Het
Ap3d1 A T 10: 80,544,313 (GRCm39) H1161Q probably benign Het
Atp2b2 C T 6: 113,750,349 (GRCm39) R625H probably damaging Het
Bdnf G A 2: 109,554,463 (GRCm39) C239Y probably damaging Het
Bpifa5 G T 2: 154,007,539 (GRCm39) probably null Het
C9 T A 15: 6,516,243 (GRCm39) F349I probably damaging Het
Ccdc180 T C 4: 45,927,975 (GRCm39) V1170A possibly damaging Het
Celsr1 A G 15: 85,815,477 (GRCm39) V1846A probably benign Het
Cep68 A T 11: 20,190,652 (GRCm39) L120H possibly damaging Het
Cntrl T A 2: 35,045,291 (GRCm39) I781K possibly damaging Het
Cpne1 G T 2: 155,919,339 (GRCm39) Q343K probably benign Het
Dlc1 A T 8: 37,405,702 (GRCm39) I29K probably benign Het
Dnah9 T C 11: 65,786,827 (GRCm39) D3602G possibly damaging Het
Dock1 A G 7: 134,475,879 (GRCm39) S885G probably benign Het
Evpl T A 11: 116,118,549 (GRCm39) Q686L probably damaging Het
Fmo6 C T 1: 162,748,132 (GRCm39) A311T probably damaging Het
Gli1 A T 10: 127,168,446 (GRCm39) M469K probably damaging Het
Grin2c G A 11: 115,141,472 (GRCm39) P882L probably damaging Het
H2-Ob C T 17: 34,461,588 (GRCm39) T109I probably damaging Het
Jpt2 C A 17: 25,167,647 (GRCm39) A101S probably benign Het
Krt1c A G 15: 101,724,932 (GRCm39) V226A probably damaging Het
Lamc1 T G 1: 153,110,341 (GRCm39) Q1111H probably damaging Het
Lamc1 T C 1: 153,110,358 (GRCm39) S1106G probably benign Het
Lamc1 C A 1: 153,110,326 (GRCm39) Q1116H possibly damaging Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp1 A T 10: 127,411,155 (GRCm39) D1399E probably benign Het
Ltbp4 G T 7: 27,024,485 (GRCm39) P715Q probably damaging Het
Mtor T C 4: 148,547,367 (GRCm39) V450A probably benign Het
Muc6 G A 7: 141,223,981 (GRCm39) probably benign Het
Myom1 A T 17: 71,428,131 (GRCm39) I1450F probably damaging Het
Naip6 A G 13: 100,420,274 (GRCm39) I1332T possibly damaging Het
Ncstn A G 1: 171,899,072 (GRCm39) V353A possibly damaging Het
Nt5c3 T C 6: 56,863,734 (GRCm39) T149A probably benign Het
Or5ac21 A T 16: 59,124,352 (GRCm39) I280F probably damaging Het
Or5p81 A G 7: 108,267,364 (GRCm39) H247R probably damaging Het
Paip1 T C 13: 119,566,854 (GRCm39) S54P possibly damaging Het
Prdm14 G T 1: 13,195,968 (GRCm39) A31E probably benign Het
Prr14l A G 5: 32,985,767 (GRCm39) S1243P probably damaging Het
Prss1 T C 6: 41,435,878 (GRCm39) M1T probably null Het
Raver2 T A 4: 100,960,147 (GRCm39) V209D probably damaging Het
Scube1 T A 15: 83,512,277 (GRCm39) probably null Het
Serpina3c T A 12: 104,117,805 (GRCm39) I178F probably damaging Het
Slc16a13 A T 11: 70,111,457 (GRCm39) V16E probably damaging Het
Slc30a6 T C 17: 74,722,640 (GRCm39) S236P possibly damaging Het
Sobp A C 10: 42,898,689 (GRCm39) S299A probably damaging Het
Sorcs3 C A 19: 48,694,448 (GRCm39) T574K possibly damaging Het
Trak2 A T 1: 58,942,820 (GRCm39) M862K probably benign Het
Ubox5 A T 2: 130,442,630 (GRCm39) V19E probably damaging Het
Vmn1r173 A G 7: 23,402,160 (GRCm39) T132A probably benign Het
Zfp267 A G 3: 36,218,711 (GRCm39) M244V probably benign Het
Zfp820 T C 17: 22,038,509 (GRCm39) D273G probably benign Het
Other mutations in Armh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Armh3 APN 19 45,928,927 (GRCm39) missense probably benign 0.19
IGL00788:Armh3 APN 19 45,920,789 (GRCm39) critical splice donor site probably null
IGL01356:Armh3 APN 19 45,954,742 (GRCm39) missense possibly damaging 0.94
IGL01477:Armh3 APN 19 45,967,043 (GRCm39) missense probably damaging 0.99
IGL01660:Armh3 APN 19 45,928,915 (GRCm39) missense probably damaging 1.00
IGL02193:Armh3 APN 19 45,961,323 (GRCm39) missense probably benign 0.02
IGL02863:Armh3 APN 19 45,946,850 (GRCm39) missense probably damaging 1.00
IGL03108:Armh3 APN 19 45,808,792 (GRCm39) missense probably damaging 0.99
R0035:Armh3 UTSW 19 45,879,679 (GRCm39) missense probably damaging 1.00
R0791:Armh3 UTSW 19 45,922,307 (GRCm39) splice site probably null
R1487:Armh3 UTSW 19 45,928,882 (GRCm39) critical splice donor site probably null
R1843:Armh3 UTSW 19 45,963,691 (GRCm39) missense probably benign 0.17
R2061:Armh3 UTSW 19 45,967,106 (GRCm39) missense probably damaging 1.00
R2070:Armh3 UTSW 19 45,879,724 (GRCm39) missense probably damaging 1.00
R2072:Armh3 UTSW 19 45,953,820 (GRCm39) missense probably damaging 0.99
R2073:Armh3 UTSW 19 45,953,820 (GRCm39) missense probably damaging 0.99
R2074:Armh3 UTSW 19 45,953,820 (GRCm39) missense probably damaging 0.99
R2091:Armh3 UTSW 19 45,941,119 (GRCm39) missense probably damaging 1.00
R2263:Armh3 UTSW 19 45,920,788 (GRCm39) critical splice donor site probably null
R2863:Armh3 UTSW 19 45,874,396 (GRCm39) missense probably damaging 1.00
R3236:Armh3 UTSW 19 45,963,722 (GRCm39) splice site probably benign
R3796:Armh3 UTSW 19 45,910,049 (GRCm39) splice site probably benign
R4044:Armh3 UTSW 19 45,808,763 (GRCm39) missense probably damaging 1.00
R4716:Armh3 UTSW 19 45,948,781 (GRCm39) missense probably damaging 1.00
R4974:Armh3 UTSW 19 45,808,726 (GRCm39) missense probably damaging 1.00
R4983:Armh3 UTSW 19 45,939,146 (GRCm39) missense probably benign
R5063:Armh3 UTSW 19 45,874,394 (GRCm39) missense possibly damaging 0.95
R5313:Armh3 UTSW 19 45,807,414 (GRCm39) missense probably damaging 1.00
R5782:Armh3 UTSW 19 45,874,466 (GRCm39) missense probably benign 0.08
R5985:Armh3 UTSW 19 45,808,763 (GRCm39) missense probably damaging 1.00
R6220:Armh3 UTSW 19 45,834,554 (GRCm39) missense possibly damaging 0.79
R6379:Armh3 UTSW 19 45,910,136 (GRCm39) missense possibly damaging 0.46
R6674:Armh3 UTSW 19 45,963,437 (GRCm39) missense probably benign 0.06
R6842:Armh3 UTSW 19 45,807,416 (GRCm39) missense probably benign 0.05
R6890:Armh3 UTSW 19 45,948,796 (GRCm39) missense probably damaging 1.00
R7034:Armh3 UTSW 19 45,953,688 (GRCm39) missense probably damaging 0.98
R7036:Armh3 UTSW 19 45,953,688 (GRCm39) missense probably damaging 0.98
R7305:Armh3 UTSW 19 45,880,560 (GRCm39) missense probably benign 0.35
R7411:Armh3 UTSW 19 45,953,874 (GRCm39) missense probably benign 0.00
R7762:Armh3 UTSW 19 45,928,882 (GRCm39) critical splice donor site probably null
R8021:Armh3 UTSW 19 45,945,180 (GRCm39) critical splice acceptor site probably null
R8366:Armh3 UTSW 19 45,920,793 (GRCm39) missense probably damaging 1.00
R9336:Armh3 UTSW 19 45,945,120 (GRCm39) missense probably damaging 1.00
X0060:Armh3 UTSW 19 45,920,832 (GRCm39) missense possibly damaging 0.95
Z1088:Armh3 UTSW 19 45,807,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAAGTCTCCGTCCTGAAAGTC -3'
(R):5'- GCTTGCCTTTACCAACTGAAGCATC -3'

Sequencing Primer
(F):5'- CGTCCTGAAAGTCACCGAG -3'
(R):5'- AATGACAGTAGCAACATTCGTC -3'
Posted On 2013-11-08