Incidental Mutation 'R0850:Gm5538'
ID82498
Institutional Source Beutler Lab
Gene Symbol Gm5538
Ensembl Gene ENSMUSG00000090527
Gene Namepredicted gene 5538
Synonyms
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59729790-59752333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 59752248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 374 (I374R)
Ref Sequence ENSEMBL: ENSMUSP00000128877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168156
AA Change: I374R

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128877
Gene: ENSMUSG00000090527
AA Change: I374R

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:DUF2424 70 214 9.3e-9 PFAM
Pfam:COesterase 91 236 5.4e-10 PFAM
Pfam:Abhydrolase_3 107 287 6.6e-36 PFAM
Pfam:Abhydrolase_3 271 375 1.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Gm5538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Gm5538 APN 3 59752121 missense possibly damaging 0.91
IGL00934:Gm5538 APN 3 59752053 missense probably benign 0.00
IGL02335:Gm5538 APN 3 59743605 missense probably benign
IGL02709:Gm5538 APN 3 59747198 missense probably damaging 1.00
IGL03114:Gm5538 APN 3 59743723 missense possibly damaging 0.55
R0107:Gm5538 UTSW 3 59752316 missense possibly damaging 0.78
R0591:Gm5538 UTSW 3 59752129 nonsense probably null
R1127:Gm5538 UTSW 3 59751893 missense probably benign 0.00
R1916:Gm5538 UTSW 3 59745503 missense possibly damaging 0.48
R3008:Gm5538 UTSW 3 59745509 missense possibly damaging 0.93
R3921:Gm5538 UTSW 3 59752077 missense probably damaging 0.98
R4368:Gm5538 UTSW 3 59751966 missense probably damaging 1.00
R5240:Gm5538 UTSW 3 59752028 missense probably damaging 0.99
R5268:Gm5538 UTSW 3 59752023 missense probably damaging 0.99
R5511:Gm5538 UTSW 3 59747264 missense probably damaging 1.00
R5564:Gm5538 UTSW 3 59752092 missense probably benign
R5812:Gm5538 UTSW 3 59747272 missense probably damaging 1.00
R5981:Gm5538 UTSW 3 59751878 missense probably benign
R6049:Gm5538 UTSW 3 59752149 missense probably damaging 1.00
R6195:Gm5538 UTSW 3 59752202 missense probably damaging 0.98
R6353:Gm5538 UTSW 3 59752108 missense probably damaging 1.00
R6449:Gm5538 UTSW 3 59745551 missense probably damaging 1.00
R6845:Gm5538 UTSW 3 59752118 missense probably damaging 1.00
R7382:Gm5538 UTSW 3 59743616 missense probably benign 0.18
R7585:Gm5538 UTSW 3 59743722 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATGACTCCCAGTTACAGAGTTTGCC -3'
(R):5'- ACCTTGCCAGGAATACAAAGTAGTGC -3'

Sequencing Primer
(F):5'- CAGAGTTTGCCATTAACGTACATCC -3'
(R):5'- TTATCATGGCCTGGGAACTAC -3'
Posted On2013-11-08