Mutagenetix > Incidental Mutation

Incidental Mutation 'R0850:Mrps15'

82502

Institutional Source

Beutler Lab

Gene Symbol

Mrps15

Ensembl Gene

ENSMUSG00000028861

Gene Name

mitochondrial ribosomal protein S15

Synonyms

1500003E24Rik

MMRRC Submission

039029-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R0850 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125940718-125949325 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125942479 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 76 (Y76C)

Ref Sequence

ENSEMBL: ENSMUSP00000030675 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000030675] [ENSMUST00000106162]

AlphaFold

Q9DC71

Predicted Effect

probably benign
Transcript: ENSMUST00000030673

SMART Domains

Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859

Domain	Start	End	E-Value	Type
Pfam:Lep_receptor_Ig	24	111	2.3e-30	PFAM
FN3	124	213	5.38e1	SMART
SCOP:d1cd9b2	226	332	3e-15	SMART
Blast:FN3	334	420	3e-30	BLAST
FN3	432	518	2.41e0	SMART
FN3	530	612	1.92e-3	SMART
transmembrane domain	627	649	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000030675
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030675
Gene: ENSMUSG00000028861
AA Change: Y76C

Domain	Start	End	E-Value	Type
low complexity region	24	40	N/A	INTRINSIC
Ribosomal_S15	108	189	4.27e-16	SMART
coiled coil region	211	242	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106162

SMART Domains

Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859

Domain	Start	End	E-Value	Type
Pfam:Lep_receptor_Ig	22	112	6.8e-30	PFAM
FN3	124	213	5.38e1	SMART
SCOP:d1cd9b2	226	332	3e-15	SMART
Blast:FN3	334	420	3e-30	BLAST
FN3	432	518	2.41e0	SMART
FN3	530	612	1.92e-3	SMART
transmembrane domain	627	649	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124614

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138739

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140426

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,642,480 (GRCm39)	T141S	probably benign	Het
Aadacl2fm2	T	G	3: 59,659,669 (GRCm39)	I374R	possibly damaging	Het
Agbl3	T	A	6: 34,776,139 (GRCm39)	F210Y	probably damaging	Het
Dgkq	A	G	5: 108,802,444 (GRCm39)	V418A	possibly damaging	Het
Dmp1	A	T	5: 104,360,653 (GRCm39)	D443V	possibly damaging	Het
Elapor2	T	A	5: 9,467,993 (GRCm39)	N220K	probably damaging	Het
Elavl3	T	G	9: 21,948,059 (GRCm39)	D35A	probably damaging	Het
Fbxo44	C	G	4: 148,240,726 (GRCm39)	R220S	probably damaging	Het
Fbxw25	T	C	9: 109,478,685 (GRCm39)	K425R	probably benign	Het
Gypa	A	G	8: 81,222,974 (GRCm39)	H26R	unknown	Het
H2-DMb1	T	C	17: 34,374,536 (GRCm39)	V62A	probably benign	Het
Helb	T	C	10: 119,941,272 (GRCm39)	H472R	probably damaging	Het
Herc1	T	G	9: 66,373,952 (GRCm39)	V3197G	probably damaging	Het
Herc2	C	A	7: 55,854,231 (GRCm39)	N3712K	probably benign	Het
Herc6	T	C	6: 57,560,227 (GRCm39)	V89A	possibly damaging	Het
Hspa1l	A	G	17: 35,196,599 (GRCm39)	T213A	probably benign	Het
Kcna7	T	C	7: 45,058,855 (GRCm39)	S381P	probably damaging	Het
Kif19a	C	A	11: 114,671,613 (GRCm39)	P164Q	probably damaging	Het
Macf1	A	G	4: 123,368,195 (GRCm39)	S2189P	probably benign	Het
Mpo	A	G	11: 87,688,328 (GRCm39)	N329S	probably damaging	Het
Or51a42	T	A	7: 103,708,252 (GRCm39)	M186L	probably benign	Het
Or6c75	T	C	10: 129,337,593 (GRCm39)	V280A	probably damaging	Het
Prdm2	T	C	4: 142,858,773 (GRCm39)	R1506G	possibly damaging	Het
Ptprb	A	T	10: 116,138,030 (GRCm39)	Q311H	possibly damaging	Het
Ptprb	T	C	10: 116,175,415 (GRCm39)	Y1137H	probably damaging	Het
Scaf8	A	G	17: 3,246,049 (GRCm39)		probably null	Het
Slc25a1	A	T	16: 17,745,145 (GRCm39)	F105Y	probably benign	Het
Slc29a4	T	C	5: 142,704,327 (GRCm39)	V327A	probably benign	Het
Spmip3	A	G	1: 177,568,571 (GRCm39)	T23A	probably benign	Het
Tmed10	A	G	12: 85,390,279 (GRCm39)	F195L	probably benign	Het
Tmem45a2	T	A	16: 56,865,732 (GRCm39)	I151F	probably benign	Het
Vmn2r93	C	A	17: 18,525,279 (GRCm39)	F312L	possibly damaging	Het
Zfp326	A	G	5: 106,026,663 (GRCm39)		probably null	Het

Other mutations in Mrps15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0441:Mrps15	UTSW	4	125,945,210 (GRCm39)	splice site	probably benign
R1721:Mrps15	UTSW	4	125,945,187 (GRCm39)	missense	probably benign	0.00
R1830:Mrps15	UTSW	4	125,949,200 (GRCm39)	missense	probably damaging	0.99
R4618:Mrps15	UTSW	4	125,940,837 (GRCm39)	unclassified	probably benign
R5590:Mrps15	UTSW	4	125,942,488 (GRCm39)	missense	probably benign	0.33
R7775:Mrps15	UTSW	4	125,945,170 (GRCm39)	missense	probably damaging	1.00
R7824:Mrps15	UTSW	4	125,945,170 (GRCm39)	missense	probably damaging	1.00
R7834:Mrps15	UTSW	4	125,949,182 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGCTTCAACCTCACTTCCAGTGAC -3'
(R):5'- GGGCTCCACAGAATCCAGTTTCAAG -3'

Sequencing Primer
(F):5'- TGGTCAACCAGCAAGCTTTG -3'
(R):5'- GTACAACAGGCCAAGTCTTTAG -3'

Posted On

2013-11-08