Incidental Mutation 'R0850:Gypa'
ID82518
Institutional Source Beutler Lab
Gene Symbol Gypa
Ensembl Gene ENSMUSG00000051839
Gene Nameglycophorin A
SynonymsCD235a, GPA
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80493781-80510542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80496345 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 26 (H26R)
Ref Sequence ENSEMBL: ENSMUSP00000070836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063359]
Predicted Effect unknown
Transcript: ENSMUST00000063359
AA Change: H26R
SMART Domains Protein: ENSMUSP00000070836
Gene: ENSMUSG00000051839
AA Change: H26R

DomainStartEndE-ValueType
Pfam:Glycophorin_A 43 162 2.5e-53 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, mutant erythrocytes had a reduced percentage of O-linked glycoproteins in the membranes, and were sensitive to hypoosmotic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Gypa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Gypa APN 8 80504779 splice site probably benign
IGL02283:Gypa APN 8 80494092 splice site probably benign
R0067:Gypa UTSW 8 80503081 missense possibly damaging 0.71
R0094:Gypa UTSW 8 80500931 missense unknown
R0563:Gypa UTSW 8 80509460 missense probably benign 0.04
R0685:Gypa UTSW 8 80496702 splice site probably benign
R0729:Gypa UTSW 8 80496792 missense unknown
R1299:Gypa UTSW 8 80496753 missense unknown
R2435:Gypa UTSW 8 80506768 splice site probably null
R4998:Gypa UTSW 8 80496335 missense unknown
R5121:Gypa UTSW 8 80496348 missense unknown
R6295:Gypa UTSW 8 80496340 missense unknown
R6827:Gypa UTSW 8 80504788 missense probably benign 0.00
Z1177:Gypa UTSW 8 80500998 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCACGGATAGAATGACTGACTGTGTAA -3'
(R):5'- GGGACTGCCATCTCACCTCCA -3'

Sequencing Primer
(F):5'- agaggcagaggcaggag -3'
(R):5'- gtgggaggcagcagtgg -3'
Posted On2013-11-08