Incidental Mutation 'R0850:Elavl3'
ID82521
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene NameELAV like RNA binding protein 3
Synonyms2600009P04Rik, Huc, mHuC
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22015005-22052023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22036763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 35 (D35A)
Ref Sequence ENSEMBL: ENSMUSP00000149816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003501] [ENSMUST00000215901]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003501
AA Change: D36A

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410
AA Change: D36A

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect probably damaging
Transcript: ENSMUST00000215901
AA Change: D35A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0022:Elavl3 UTSW 9 22036871 splice site probably benign
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3714:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3715:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R6593:Elavl3 UTSW 9 22018547 missense possibly damaging 0.58
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
R7897:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
R7980:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGAGTGACTTCCCTAGTCTGCC -3'
(R):5'- TTTCCTGCTCTAGCCCAGTGATGG -3'

Sequencing Primer
(F):5'- TTCCCCAGAGAGCCACTTG -3'
(R):5'- CAGTGATGGGGACTGGGC -3'
Posted On2013-11-08