Incidental Mutation 'R0850:Slc25a1'
ID82531
Institutional Source Beutler Lab
Gene Symbol Slc25a1
Ensembl Gene ENSMUSG00000003528
Gene Namesolute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
SynonymsDgsj, 2610100G11Rik, 1300019P08Rik, Slc20a3
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0850 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17925223-17928219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17927281 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 105 (F105Y)
Ref Sequence ENSEMBL: ENSMUSP00000003622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003622]
Predicted Effect probably benign
Transcript: ENSMUST00000003622
AA Change: F105Y

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003622
Gene: ENSMUSG00000003528
AA Change: F105Y

DomainStartEndE-ValueType
Pfam:Mito_carr 21 116 2.1e-22 PFAM
Pfam:Mito_carr 118 213 9.7e-19 PFAM
Pfam:Mito_carr 216 308 5.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129270
Predicted Effect unknown
Transcript: ENSMUST00000131507
AA Change: S21T
SMART Domains Protein: ENSMUSP00000123613
Gene: ENSMUSG00000003528
AA Change: S21T

DomainStartEndE-ValueType
Pfam:Mito_carr 14 99 1.2e-12 PFAM
Pfam:Mito_carr 102 194 5.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193194
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fbxw25 T C 9: 109,649,617 K425R probably benign Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Slc25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Slc25a1 APN 16 17926066 missense probably damaging 1.00
IGL01940:Slc25a1 APN 16 17926440 missense probably benign 0.00
IGL02076:Slc25a1 APN 16 17927626 missense possibly damaging 0.94
IGL02137:Slc25a1 APN 16 17927370 missense probably benign 0.14
IGL03399:Slc25a1 APN 16 17925820 missense probably damaging 0.97
R0744:Slc25a1 UTSW 16 17927436 missense probably benign 0.04
R0747:Slc25a1 UTSW 16 17926220 missense probably damaging 0.99
R0836:Slc25a1 UTSW 16 17927436 missense probably benign 0.04
R2290:Slc25a1 UTSW 16 17925848 missense possibly damaging 0.92
R2890:Slc25a1 UTSW 16 17926099 missense probably damaging 1.00
R6885:Slc25a1 UTSW 16 17927430 missense probably benign 0.00
R7503:Slc25a1 UTSW 16 17926439 nonsense probably null
R7840:Slc25a1 UTSW 16 17926274 missense probably benign 0.00
R7923:Slc25a1 UTSW 16 17926274 missense probably benign 0.00
Z1088:Slc25a1 UTSW 16 17927206 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGCTACCCCTGAAAGGCTCAATC -3'
(R):5'- CTTCCCGACCGAATACGTGAAGAC -3'

Sequencing Primer
(F):5'- AAGGCTCAATCCCTCACCTTG -3'
(R):5'- TACCGGGGCATCGGTAAG -3'
Posted On2013-11-08