Incidental Mutation 'H8441:Stk32b'
ID 82539
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Name serine/threonine kinase 32B
Synonyms YANK2, 2510009F08Rik, Stk32, STKG6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # H8441 (G3) of strain 599
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 37446825-37717171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37457234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 310 (D310G)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
AlphaFold Q9JJX8
Predicted Effect probably damaging
Transcript: ENSMUST00000094836
AA Change: D310G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: D310G

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A C 11: 50,784,678 D677A probably damaging Het
Dido1 G T 2: 180,689,014 Q214K probably benign Het
Gm8909 T A 17: 36,167,982 Q125L possibly damaging Het
Itgbl1 A G 14: 123,973,287 N342D probably damaging Het
Mlxipl T C 5: 135,123,961 I282T probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Phf2 C T 13: 48,804,365 A1058T possibly damaging Het
Pja2 T C 17: 64,311,197 D69G probably damaging Het
Pnmt G A 11: 98,387,687 A160T probably benign Het
Pomgnt2 T G 9: 121,982,584 Y377S probably damaging Het
Scn11a T A 9: 119,807,910 I242F probably damaging Het
Slc7a1 C T 5: 148,334,545 V535M probably benign Het
Sult3a2 A T 10: 33,766,478 H276Q probably benign Het
Susd5 A T 9: 114,096,185 K379* probably null Het
Tbc1d16 C A 11: 119,149,014 E656* probably null Het
Tcp10b T C 17: 13,070,861 S234P probably damaging Het
Vmo1 A G 11: 70,513,746 F143S probably damaging Het
Zfp609 T C 9: 65,794,887 E161G possibly damaging Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
flank UTSW 5 37466781 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R3899:Stk32b UTSW 5 37457154 missense probably damaging 1.00
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6610:Stk32b UTSW 5 37448678 missense probably benign 0.04
R6864:Stk32b UTSW 5 37448805 splice site probably null
R6879:Stk32b UTSW 5 37490523 missense possibly damaging 0.77
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
R8676:Stk32b UTSW 5 37457159 missense probably benign 0.00
R8795:Stk32b UTSW 5 37649139 missense probably damaging 0.98
R8948:Stk32b UTSW 5 37454997 missense possibly damaging 0.87
R9192:Stk32b UTSW 5 37629000 missense probably damaging 1.00
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAACAGCAATGTCCACCACC -3'
(R):5'- TGGGACTGTGTCTCTGAACCGATG -3'

Sequencing Primer
(F):5'- tcaagtaatggaagtaatcccaaag -3'
(R):5'- TCTCTGAACCGATGGTGTG -3'
Posted On 2013-11-08