Incidental Mutation 'H8441:Susd5'
ID82546
Institutional Source Beutler Lab
Gene Symbol Susd5
Ensembl Gene ENSMUSG00000086596
Gene Namesushi domain containing 5
SynonymsLOC382111
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #H8441 (G3) of strain 599
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location114057140-114098728 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 114096185 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 379 (K379*)
Ref Sequence ENSEMBL: ENSMUSP00000128826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135338]
Predicted Effect probably null
Transcript: ENSMUST00000135338
AA Change: K379*
SMART Domains Protein: ENSMUSP00000128826
Gene: ENSMUSG00000086596
AA Change: K379*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LINK 33 130 7.42e-26 SMART
CCP 136 193 9.65e-1 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 485 496 N/A INTRINSIC
transmembrane domain 566 588 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A C 11: 50,784,678 D677A probably damaging Het
Dido1 G T 2: 180,689,014 Q214K probably benign Het
Gm8909 T A 17: 36,167,982 Q125L possibly damaging Het
Itgbl1 A G 14: 123,973,287 N342D probably damaging Het
Mlxipl T C 5: 135,123,961 I282T probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Phf2 C T 13: 48,804,365 A1058T possibly damaging Het
Pja2 T C 17: 64,311,197 D69G probably damaging Het
Pnmt G A 11: 98,387,687 A160T probably benign Het
Pomgnt2 T G 9: 121,982,584 Y377S probably damaging Het
Scn11a T A 9: 119,807,910 I242F probably damaging Het
Slc7a1 C T 5: 148,334,545 V535M probably benign Het
Stk32b T C 5: 37,457,234 D310G probably damaging Het
Sult3a2 A T 10: 33,766,478 H276Q probably benign Het
Tbc1d16 C A 11: 119,149,014 E656* probably null Het
Tcp10b T C 17: 13,070,861 S234P probably damaging Het
Vmo1 A G 11: 70,513,746 F143S probably damaging Het
Zfp609 T C 9: 65,794,887 E161G possibly damaging Het
Other mutations in Susd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Susd5 APN 9 114068879 splice site probably benign
IGL01720:Susd5 APN 9 114063984 missense possibly damaging 0.85
IGL02739:Susd5 APN 9 114096033 missense possibly damaging 0.72
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0650:Susd5 UTSW 9 114082535 missense possibly damaging 0.53
R0666:Susd5 UTSW 9 114095784 missense possibly damaging 0.53
R1478:Susd5 UTSW 9 114096684 missense probably benign
R1672:Susd5 UTSW 9 114068822 missense probably damaging 0.99
R3416:Susd5 UTSW 9 114095658 missense possibly damaging 0.85
R3965:Susd5 UTSW 9 114096192 missense possibly damaging 0.72
R4182:Susd5 UTSW 9 114095985 missense probably benign 0.12
R4514:Susd5 UTSW 9 114095924 missense probably benign 0.18
R5373:Susd5 UTSW 9 114082585 missense probably damaging 1.00
R5947:Susd5 UTSW 9 114057591 missense possibly damaging 0.96
R6189:Susd5 UTSW 9 114095658 missense probably damaging 0.98
R6349:Susd5 UTSW 9 114095802 missense probably benign 0.33
R7535:Susd5 UTSW 9 114064040 missense possibly damaging 0.92
Z1176:Susd5 UTSW 9 114096140 missense probably damaging 0.98
Z1177:Susd5 UTSW 9 114064067 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCACAAGCCAGAGCTGGGAAAG -3'
(R):5'- ACGTCGAGCATTTGAGATGGACTG -3'

Sequencing Primer
(F):5'- TGCCAGAGACAATCACAGTG -3'
(R):5'- ACTGATCGAGCTGTGTATCAC -3'
Posted On2013-11-08