Incidental Mutation 'R0941:Atp1b1'
ID 82566
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb-1, Atpb, sodium/potassium ATPase beta subunit
MMRRC Submission 039080-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R0941 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 164264678-164285924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 164270829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 50 (I50S)
Ref Sequence ENSEMBL: ENSMUSP00000141777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000193367]
AlphaFold P14094
Predicted Effect probably benign
Transcript: ENSMUST00000027863
AA Change: I106S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: I106S

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193367
AA Change: I50S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576
AA Change: I50S

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,931,414 (GRCm39) M203I probably benign Het
Afmid T A 11: 117,726,071 (GRCm39) probably benign Het
Ahnak A G 19: 8,987,278 (GRCm39) D2854G probably damaging Het
Amotl1 A C 9: 14,507,854 (GRCm39) I31S possibly damaging Het
Arf3 A G 15: 98,638,984 (GRCm39) V91A probably benign Het
Baz1a A T 12: 54,945,216 (GRCm39) S1380T probably benign Het
C4b T A 17: 34,959,029 (GRCm39) T467S probably benign Het
Casd1 T C 6: 4,635,848 (GRCm39) S640P probably damaging Het
Col4a1 C T 8: 11,258,296 (GRCm39) G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fhip1a G T 3: 85,580,366 (GRCm39) P613Q probably benign Het
Gm12695 C A 4: 96,616,454 (GRCm39) E460* probably null Het
Gnmt A G 17: 47,037,271 (GRCm39) L171P probably damaging Het
Gpc1 G A 1: 92,785,031 (GRCm39) R358H possibly damaging Het
Igsf8 C T 1: 172,143,963 (GRCm39) R39C probably damaging Het
Kdm3b T A 18: 34,936,605 (GRCm39) C296S probably damaging Het
Lama1 C T 17: 68,082,860 (GRCm39) P1373S probably benign Het
Lamc1 A G 1: 153,208,020 (GRCm39) L89P possibly damaging Het
Ltc4s T G 11: 50,128,269 (GRCm39) probably null Het
Met A T 6: 17,491,393 (GRCm39) I52F probably damaging Het
Mterf2 G A 10: 84,955,934 (GRCm39) T230M possibly damaging Het
Mybpc2 T C 7: 44,156,311 (GRCm39) K834R probably benign Het
Npr1 A T 3: 90,368,716 (GRCm39) I448N probably benign Het
Or52u1 C T 7: 104,237,545 (GRCm39) T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Serpini1 A T 3: 75,523,934 (GRCm39) I181F probably damaging Het
Shc3 T C 13: 51,634,242 (GRCm39) M88V probably benign Het
Skint6 T A 4: 113,095,555 (GRCm39) S35C probably damaging Het
Spta1 T C 1: 174,072,771 (GRCm39) probably benign Het
Sult2a2 C T 7: 13,468,815 (GRCm39) R94* probably null Het
Trim9 A G 12: 70,295,037 (GRCm39) V787A probably damaging Het
Ttn A G 2: 76,549,367 (GRCm39) V31770A probably benign Het
Unc5d T C 8: 29,249,055 (GRCm39) N337D possibly damaging Het
Vmn2r7 A T 3: 64,624,000 (GRCm39) Y107N probably benign Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164,285,330 (GRCm39) missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164,265,918 (GRCm39) missense probably damaging 1.00
R1034:Atp1b1 UTSW 1 164,281,057 (GRCm39) critical splice donor site probably null
R1597:Atp1b1 UTSW 1 164,265,889 (GRCm39) missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164,281,084 (GRCm39) missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3819:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164,281,127 (GRCm39) missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164,265,867 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACGAGAATTCCGTGACATTGCC -3'
(R):5'- TTTAATCCATCCCGTGAGCCAAGTG -3'

Sequencing Primer
(F):5'- TGCCTTTAAACTACTAAAGCAACGG -3'
(R):5'- CGTGAGCCAAGTGGGAATG -3'
Posted On 2013-11-08