Mutagenetix > Incidental Mutation

Incidental Mutation 'R0941:Spta1'

82568

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

039080-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R0941 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

174000342-174076016 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 174072771 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]

AlphaFold

P08032

Predicted Effect

probably benign
Transcript: ENSMUST00000027817

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000061990

SMART Domains

Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1.4e-53	PFAM
Pfam:7tm_1	41	290	3.2e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Predicted Effect

probably benign
Transcript: ENSMUST00000214725

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 96.9%
20x: 93.9%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa2	G	T	18: 74,931,414 (GRCm39)	M203I	probably benign	Het
Afmid	T	A	11: 117,726,071 (GRCm39)		probably benign	Het
Ahnak	A	G	19: 8,987,278 (GRCm39)	D2854G	probably damaging	Het
Amotl1	A	C	9: 14,507,854 (GRCm39)	I31S	possibly damaging	Het
Arf3	A	G	15: 98,638,984 (GRCm39)	V91A	probably benign	Het
Atp1b1	A	C	1: 164,270,829 (GRCm39)	I50S	probably benign	Het
Baz1a	A	T	12: 54,945,216 (GRCm39)	S1380T	probably benign	Het
C4b	T	A	17: 34,959,029 (GRCm39)	T467S	probably benign	Het
Casd1	T	C	6: 4,635,848 (GRCm39)	S640P	probably damaging	Het
Col4a1	C	T	8: 11,258,296 (GRCm39)	G1396S	unknown	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,084,988 (GRCm39)		probably benign	Het
Fhip1a	G	T	3: 85,580,366 (GRCm39)	P613Q	probably benign	Het
Gm12695	C	A	4: 96,616,454 (GRCm39)	E460*	probably null	Het
Gnmt	A	G	17: 47,037,271 (GRCm39)	L171P	probably damaging	Het
Gpc1	G	A	1: 92,785,031 (GRCm39)	R358H	possibly damaging	Het
Igsf8	C	T	1: 172,143,963 (GRCm39)	R39C	probably damaging	Het
Kdm3b	T	A	18: 34,936,605 (GRCm39)	C296S	probably damaging	Het
Lama1	C	T	17: 68,082,860 (GRCm39)	P1373S	probably benign	Het
Lamc1	A	G	1: 153,208,020 (GRCm39)	L89P	possibly damaging	Het
Ltc4s	T	G	11: 50,128,269 (GRCm39)		probably null	Het
Met	A	T	6: 17,491,393 (GRCm39)	I52F	probably damaging	Het
Mterf2	G	A	10: 84,955,934 (GRCm39)	T230M	possibly damaging	Het
Mybpc2	T	C	7: 44,156,311 (GRCm39)	K834R	probably benign	Het
Npr1	A	T	3: 90,368,716 (GRCm39)	I448N	probably benign	Het
Or52u1	C	T	7: 104,237,545 (GRCm39)	T178I	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,000,336 (GRCm39)		probably benign	Het
Serpini1	A	T	3: 75,523,934 (GRCm39)	I181F	probably damaging	Het
Shc3	T	C	13: 51,634,242 (GRCm39)	M88V	probably benign	Het
Skint6	T	A	4: 113,095,555 (GRCm39)	S35C	probably damaging	Het
Sult2a2	C	T	7: 13,468,815 (GRCm39)	R94*	probably null	Het
Trim9	A	G	12: 70,295,037 (GRCm39)	V787A	probably damaging	Het
Ttn	A	G	2: 76,549,367 (GRCm39)	V31770A	probably benign	Het
Unc5d	T	C	8: 29,249,055 (GRCm39)	N337D	possibly damaging	Het
Vmn2r7	A	T	3: 64,624,000 (GRCm39)	Y107N	probably benign	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174,035,956 (GRCm39)	nonsense	probably null
IGL01095:Spta1	APN	1	174,041,051 (GRCm39)	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174,014,829 (GRCm39)	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174,030,877 (GRCm39)	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174,044,725 (GRCm39)	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174,035,960 (GRCm39)	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174,071,746 (GRCm39)	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174,001,938 (GRCm39)	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174,041,428 (GRCm39)	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174,030,860 (GRCm39)	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174,017,797 (GRCm39)	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174,045,255 (GRCm39)	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174,002,029 (GRCm39)	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174,046,380 (GRCm39)	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174,071,676 (GRCm39)	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174,039,164 (GRCm39)	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174,014,854 (GRCm39)	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174,008,624 (GRCm39)	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174,046,309 (GRCm39)	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174,041,484 (GRCm39)	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174,041,710 (GRCm39)	missense	probably benign	0.08
bounced	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
Capillus	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
Deflection	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
Goldfoil	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
hanging	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
Klimt	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
Rutherford	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
Thread	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
H8786:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174,034,598 (GRCm39)	splice site	probably benign
R0172:Spta1	UTSW	1	174,058,352 (GRCm39)	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174,045,460 (GRCm39)	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174,070,745 (GRCm39)	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174,046,017 (GRCm39)	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174,041,508 (GRCm39)	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174,008,670 (GRCm39)	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174,001,992 (GRCm39)	missense	possibly damaging	0.85
R1131:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174,039,180 (GRCm39)	nonsense	probably null
R1184:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174,050,250 (GRCm39)	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174,058,891 (GRCm39)	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174,074,919 (GRCm39)	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174,067,732 (GRCm39)	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174,012,272 (GRCm39)	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174,041,061 (GRCm39)	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174,068,608 (GRCm39)	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174,073,296 (GRCm39)	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174,074,115 (GRCm39)	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174,023,513 (GRCm39)	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174,047,405 (GRCm39)	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174,039,213 (GRCm39)	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174,071,764 (GRCm39)	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174,035,910 (GRCm39)	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174,040,180 (GRCm39)	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174,056,824 (GRCm39)	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174,020,532 (GRCm39)	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174,071,680 (GRCm39)	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174,001,907 (GRCm39)	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174,006,222 (GRCm39)	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174,068,703 (GRCm39)	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174,002,122 (GRCm39)	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174,067,923 (GRCm39)	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174,007,418 (GRCm39)	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174,074,990 (GRCm39)	nonsense	probably null
R4525:Spta1	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
R4614:Spta1	UTSW	1	174,020,543 (GRCm39)	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174,018,628 (GRCm39)	splice site	probably null
R4782:Spta1	UTSW	1	174,058,232 (GRCm39)	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174,065,493 (GRCm39)	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174,065,400 (GRCm39)	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174,045,429 (GRCm39)	splice site	probably null
R4911:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174,018,622 (GRCm39)	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174,074,174 (GRCm39)	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174,067,789 (GRCm39)	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174,075,000 (GRCm39)	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174,023,551 (GRCm39)	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174,043,095 (GRCm39)	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174,044,759 (GRCm39)	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174,003,336 (GRCm39)	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174,047,468 (GRCm39)	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174,041,821 (GRCm39)	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174,012,363 (GRCm39)	splice site	probably null
R5845:Spta1	UTSW	1	174,068,662 (GRCm39)	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174,050,894 (GRCm39)	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174,052,086 (GRCm39)	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174,009,342 (GRCm39)	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174,041,743 (GRCm39)	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174,039,212 (GRCm39)	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174,041,734 (GRCm39)	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174,030,888 (GRCm39)	missense	probably benign
R6387:Spta1	UTSW	1	174,058,899 (GRCm39)	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174,044,767 (GRCm39)	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174,014,714 (GRCm39)	splice site	probably null
R6533:Spta1	UTSW	1	174,071,713 (GRCm39)	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174,006,251 (GRCm39)	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174,036,891 (GRCm39)	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174,036,918 (GRCm39)	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174,027,050 (GRCm39)	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174,002,076 (GRCm39)	missense	probably benign
R7151:Spta1	UTSW	1	174,025,317 (GRCm39)	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174,012,178 (GRCm39)	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174,050,837 (GRCm39)	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174,050,203 (GRCm39)	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174,050,915 (GRCm39)	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
R7472:Spta1	UTSW	1	174,074,065 (GRCm39)	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174,025,349 (GRCm39)	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174,032,944 (GRCm39)	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174,023,547 (GRCm39)	nonsense	probably null
R7784:Spta1	UTSW	1	174,030,017 (GRCm39)	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174,023,471 (GRCm39)	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174,046,396 (GRCm39)	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174,025,351 (GRCm39)	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174,001,956 (GRCm39)	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174,067,737 (GRCm39)	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174,045,936 (GRCm39)	intron	probably benign
R8076:Spta1	UTSW	1	174,014,797 (GRCm39)	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174,045,510 (GRCm39)	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174,007,387 (GRCm39)	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174,074,953 (GRCm39)	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174,067,777 (GRCm39)	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174,043,051 (GRCm39)	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174,014,774 (GRCm39)	missense	probably damaging	1.00
R8675:Spta1	UTSW	1	174,058,249 (GRCm39)	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174,025,310 (GRCm39)	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174,021,145 (GRCm39)	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174,045,548 (GRCm39)	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174,058,241 (GRCm39)	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174,047,537 (GRCm39)	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174,050,174 (GRCm39)	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174,045,170 (GRCm39)	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174,058,911 (GRCm39)	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174,039,139 (GRCm39)	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174,067,750 (GRCm39)	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174,047,444 (GRCm39)	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174,045,204 (GRCm39)	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174,035,978 (GRCm39)	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174,032,925 (GRCm39)	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174,058,926 (GRCm39)	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174,036,885 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,045,469 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,041,010 (GRCm39)	missense	probably benign	0.42
T0722:Spta1	UTSW	1	174,018,632 (GRCm39)	splice site	probably benign
X0028:Spta1	UTSW	1	174,052,016 (GRCm39)	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	probably damaging	0.99
Z1176:Spta1	UTSW	1	174,018,617 (GRCm39)	missense	probably damaging	1.00
Z1177:Spta1	UTSW	1	174,073,255 (GRCm39)	missense	probably benign	0.02
Z1177:Spta1	UTSW	1	174,017,728 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TCCAATTTTCAGGGTCCCTTTAACATCG -3'
(R):5'- TCTTACTCATTCTGTTCTCCAAAGCAGC -3'

Sequencing Primer
(F):5'- tcagcaataaagaaatgttgaaacc -3'
(R):5'- CACCAGTTGAATGATGATTGAAAGAC -3'

Posted On

2013-11-08