Incidental Mutation 'R0941:Fam160a1'
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85673059 bp
Amino Acid Change Proline to Glutamine at position 613 (P613Q)
Ref Sequence ENSEMBL: ENSMUSP00000113235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably benign
Transcript: ENSMUST00000094148
AA Change: P613Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: P613Q

Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118408
AA Change: P613Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: P613Q

Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126445
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Arf3 A G 15: 98,741,103 V91A probably benign Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Gm12695 C A 4: 96,728,217 E460* probably null Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Sult2a2 C T 7: 13,734,890 R94* probably null Het
Trim9 A G 12: 70,248,263 V787A probably damaging Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4520001:Fam160a1 UTSW 3 85672472 nonsense probably null
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0590:Fam160a1 UTSW 3 85672376 missense probably benign 0.13
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1820:Fam160a1 UTSW 3 85665829 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4601:Fam160a1 UTSW 3 85741180 missense probably damaging 1.00
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6789:Fam160a1 UTSW 3 85672558 nonsense probably null
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
R7406:Fam160a1 UTSW 3 85730477 missense probably benign 0.13
R7448:Fam160a1 UTSW 3 85672564 missense probably benign 0.00
R7469:Fam160a1 UTSW 3 85672762 missense probably benign 0.00
R7578:Fam160a1 UTSW 3 85665898 missense probably damaging 0.99
R7707:Fam160a1 UTSW 3 85676253 missense probably benign 0.21
R8071:Fam160a1 UTSW 3 85730561 missense probably damaging 1.00
R8093:Fam160a1 UTSW 3 85672804 missense probably benign 0.01
R8151:Fam160a1 UTSW 3 85688540 missense probably damaging 1.00
R8391:Fam160a1 UTSW 3 85688481 missense probably damaging 0.98
R8406:Fam160a1 UTSW 3 85672720 missense probably benign 0.02
R8774:Fam160a1 UTSW 3 85672790 missense probably benign 0.00
R8774-TAIL:Fam160a1 UTSW 3 85672790 missense probably benign 0.00
Z1176:Fam160a1 UTSW 3 85673201 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-11-08