Incidental Mutation 'R0941:Gm12695'
ID82576
Institutional Source Beutler Lab
Gene Symbol Gm12695
Ensembl Gene ENSMUSG00000078639
Gene Namepredicted gene 12695
Synonyms
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96723647-96785186 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 96728217 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 460 (E460*)
Ref Sequence ENSEMBL: ENSMUSP00000102686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107071]
Predicted Effect probably null
Transcript: ENSMUST00000107071
AA Change: E460*
SMART Domains Protein: ENSMUSP00000102686
Gene: ENSMUSG00000078639
AA Change: E460*

DomainStartEndE-ValueType
low complexity region 226 237 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Arf3 A G 15: 98,741,103 V91A probably benign Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam160a1 G T 3: 85,673,059 P613Q probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Sult2a2 C T 7: 13,734,890 R94* probably null Het
Trim9 A G 12: 70,248,263 V787A probably damaging Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Gm12695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Gm12695 APN 4 96749182 missense probably damaging 1.00
IGL01016:Gm12695 APN 4 96757947 missense probably benign 0.03
IGL02605:Gm12695 APN 4 96762751 missense probably null 0.92
IGL02734:Gm12695 APN 4 96724030 nonsense probably null
IGL02869:Gm12695 APN 4 96762133 splice site probably benign
IGL02895:Gm12695 APN 4 96723949 missense probably damaging 0.99
R0020:Gm12695 UTSW 4 96769735 missense probably damaging 0.96
R0465:Gm12695 UTSW 4 96785075 missense probably damaging 1.00
R0968:Gm12695 UTSW 4 96762066 missense probably damaging 1.00
R1965:Gm12695 UTSW 4 96762845 missense probably benign 0.16
R1983:Gm12695 UTSW 4 96738977 missense possibly damaging 0.84
R2051:Gm12695 UTSW 4 96769771 missense probably damaging 0.99
R2063:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2064:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2065:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2066:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2067:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2073:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2075:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2233:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2234:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2327:Gm12695 UTSW 4 96769656 missense probably benign 0.00
R2507:Gm12695 UTSW 4 96754189 missense probably damaging 0.99
R3836:Gm12695 UTSW 4 96762097 missense probably damaging 0.99
R4685:Gm12695 UTSW 4 96761980 missense probably damaging 1.00
R5491:Gm12695 UTSW 4 96769668 missense possibly damaging 0.84
R5792:Gm12695 UTSW 4 96728283 missense probably benign 0.00
R6767:Gm12695 UTSW 4 96762696 intron probably null
R6786:Gm12695 UTSW 4 96762821 missense probably damaging 1.00
R6874:Gm12695 UTSW 4 96785069 missense probably benign 0.04
R6923:Gm12695 UTSW 4 96769816 missense probably benign 0.00
R6978:Gm12695 UTSW 4 96769722 missense possibly damaging 0.69
R7810:Gm12695 UTSW 4 96731371 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCATGAGATGAAAGCAAGCC -3'
(R):5'- CTCACAGAGTAGGACATCAGAACGC -3'

Sequencing Primer
(F):5'- ACCTTACCTGTGTTGCTCAG -3'
(R):5'- ACTTGACAGTTAGAGCTGCC -3'
Posted On2013-11-08