Incidental Mutation 'R0941:Sult2a2'
ID82581
Institutional Source Beutler Lab
Gene Symbol Sult2a2
Ensembl Gene ENSMUSG00000070811
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2
SynonymsC730007P19Rik, Sth2, mSTa2
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13733505-13779636 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 13734890 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 94 (R94*)
Ref Sequence ENSEMBL: ENSMUSP00000083317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086148]
Predicted Effect probably null
Transcript: ENSMUST00000086148
AA Change: R94*
SMART Domains Protein: ENSMUSP00000083317
Gene: ENSMUSG00000070811
AA Change: R94*

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 162 2.3e-37 PFAM
Pfam:Sulfotransfer_1 157 187 1.3e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Arf3 A G 15: 98,741,103 V91A probably benign Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam160a1 G T 3: 85,673,059 P613Q probably benign Het
Gm12695 C A 4: 96,728,217 E460* probably null Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Trim9 A G 12: 70,248,263 V787A probably damaging Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Sult2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Sult2a2 APN 7 13734759 missense probably damaging 1.00
IGL01504:Sult2a2 APN 7 13738264 missense probably damaging 1.00
IGL01833:Sult2a2 APN 7 13734796 missense probably damaging 0.99
IGL03162:Sult2a2 APN 7 13734897 missense probably damaging 0.96
IGL03408:Sult2a2 APN 7 13738229 missense probably damaging 1.00
R1109:Sult2a2 UTSW 7 13734873 missense probably benign 0.01
R1376:Sult2a2 UTSW 7 13734771 missense probably damaging 0.99
R1376:Sult2a2 UTSW 7 13734771 missense probably damaging 0.99
R4114:Sult2a2 UTSW 7 13734783 missense probably benign 0.00
R4116:Sult2a2 UTSW 7 13734783 missense probably benign 0.00
R4940:Sult2a2 UTSW 7 13738298 missense probably benign 0.03
R5023:Sult2a2 UTSW 7 13734860 missense possibly damaging 0.79
R5510:Sult2a2 UTSW 7 13738303 missense probably damaging 0.99
R7424:Sult2a2 UTSW 7 13734897 missense possibly damaging 0.79
R7569:Sult2a2 UTSW 7 13779505 missense probably benign
R7800:Sult2a2 UTSW 7 13734785 missense probably benign 0.30
R8842:Sult2a2 UTSW 7 13738267 missense probably damaging 1.00
R8948:Sult2a2 UTSW 7 13733559 start codon destroyed probably damaging 0.96
R8950:Sult2a2 UTSW 7 13733559 start codon destroyed probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGCTTGAAATTGGGCAGCACTG -3'
(R):5'- CAGCAAGAACTCCAGGACTTGTCAG -3'

Sequencing Primer
(F):5'- CAGCACTGTAAATTGTATGGGC -3'
(R):5'- CAGGACTTGTCAGGTAAAATAAGTTG -3'
Posted On2013-11-08