Incidental Mutation 'R0941:Arf3'
ID82594
Institutional Source Beutler Lab
Gene Symbol Arf3
Ensembl Gene ENSMUSG00000051853
Gene NameADP-ribosylation factor 3
Synonyms
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98736634-98763214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98741103 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000050689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053183] [ENSMUST00000156572]
Predicted Effect probably benign
Transcript: ENSMUST00000053183
AA Change: V91A

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050689
Gene: ENSMUSG00000051853
AA Change: V91A

DomainStartEndE-ValueType
ARF 1 181 2.95e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129354
Predicted Effect probably benign
Transcript: ENSMUST00000156572
Meta Mutation Damage Score 0.9577 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor 3 (ARF3) is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2,and ARF3), class II (ARF4 and ARF5) and class III (ARF6) and members of each class share a common gene organization. The ARF3 gene contains five exons and four introns. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam160a1 G T 3: 85,673,059 P613Q probably benign Het
Gm12695 C A 4: 96,728,217 E460* probably null Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Sult2a2 C T 7: 13,734,890 R94* probably null Het
Trim9 A G 12: 70,248,263 V787A probably damaging Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Arf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1385:Arf3 UTSW 15 98742613 missense probably damaging 1.00
R1591:Arf3 UTSW 15 98742788 start gained probably benign
R1808:Arf3 UTSW 15 98741073 missense probably benign
R2197:Arf3 UTSW 15 98741404 missense probably benign 0.02
R7316:Arf3 UTSW 15 98740993 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAACCCGTCAGCAGTAGTTCC -3'
(R):5'- GTGCAGAGCATGGCTGTTCTCTTAG -3'

Sequencing Primer
(F):5'- GGCCTTTCACCCACGAG -3'
(R):5'- CTGTTCTCTTAGTTATGGGTGGC -3'
Posted On2013-11-08