Incidental Mutation 'R0941:Gnmt'
Institutional Source Beutler Lab
Gene Symbol Gnmt
Ensembl Gene ENSMUSG00000002769
Gene Nameglycine N-methyltransferase
Synonymsglycine N methyl transferase
MMRRC Submission 039080-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R0941 (G1)
Quality Score225
Status Validated
Chromosomal Location46725664-46729168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46726345 bp
Amino Acid Change Leucine to Proline at position 171 (L171P)
Ref Sequence ENSEMBL: ENSMUSP00000002846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
PDB Structure Crystal Structure of Mouse Glycine N-Methyltransferase (Tetragonal Form) [X-RAY DIFFRACTION]
Crystal Structure of Mouse Glycine N-Methyltransferase (Monoclinic Form) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763

low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000002846
AA Change: L171P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769
AA Change: L171P

Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display elevated levels of methionine and S-adenosylmethionine in the liver. Mice homozygous for another null allele exhibit hepatitis, increased hepatic glycogen storage, and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G T 18: 74,798,343 M203I probably benign Het
Afmid T A 11: 117,835,245 probably benign Het
Ahnak A G 19: 9,009,914 D2854G probably damaging Het
Amotl1 A C 9: 14,596,558 I31S possibly damaging Het
Arf3 A G 15: 98,741,103 V91A probably benign Het
Atp1b1 A C 1: 164,443,260 I50S probably benign Het
Baz1a A T 12: 54,898,431 S1380T probably benign Het
C4b T A 17: 34,740,055 T467S probably benign Het
Casd1 T C 6: 4,635,848 S640P probably damaging Het
Col4a1 C T 8: 11,208,296 G1396S unknown Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam160a1 G T 3: 85,673,059 P613Q probably benign Het
Gm12695 C A 4: 96,728,217 E460* probably null Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Igsf8 C T 1: 172,316,396 R39C probably damaging Het
Kdm3b T A 18: 34,803,552 C296S probably damaging Het
Lama1 C T 17: 67,775,865 P1373S probably benign Het
Lamc1 A G 1: 153,332,274 L89P possibly damaging Het
Ltc4s T G 11: 50,237,442 probably null Het
Met A T 6: 17,491,394 I52F probably damaging Het
Mterf2 G A 10: 85,120,070 T230M possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Npr1 A T 3: 90,461,409 I448N probably benign Het
Olfr654 C T 7: 104,588,338 T178I probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Serpini1 A T 3: 75,616,627 I181F probably damaging Het
Shc3 T C 13: 51,480,206 M88V probably benign Het
Skint6 T A 4: 113,238,358 S35C probably damaging Het
Spta1 T C 1: 174,245,205 probably benign Het
Sult2a2 C T 7: 13,734,890 R94* probably null Het
Trim9 A G 12: 70,248,263 V787A probably damaging Het
Ttn A G 2: 76,719,023 V31770A probably benign Het
Unc5d T C 8: 28,759,027 N337D possibly damaging Het
Vmn2r7 A T 3: 64,716,579 Y107N probably benign Het
Other mutations in Gnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gnmt APN 17 46726680 missense probably benign 0.28
health_nut UTSW 17 46726345 missense probably damaging 1.00
impulsive UTSW 17 46725966 missense probably damaging 1.00
rash UTSW 17 46725736 utr 3 prime probably benign
R0480:Gnmt UTSW 17 46725928 missense probably benign 0.06
R0938:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0939:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0940:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R3619:Gnmt UTSW 17 46729037 missense possibly damaging 0.63
R4173:Gnmt UTSW 17 46726121 missense probably damaging 1.00
R4456:Gnmt UTSW 17 46728984 missense probably benign 0.07
R4498:Gnmt UTSW 17 46725736 utr 3 prime probably benign
R4659:Gnmt UTSW 17 46725966 missense probably damaging 1.00
R4669:Gnmt UTSW 17 46726299 nonsense probably null
R4827:Gnmt UTSW 17 46727319 missense possibly damaging 0.77
R5112:Gnmt UTSW 17 46726330 missense probably damaging 1.00
R5133:Gnmt UTSW 17 46725934 missense probably benign
R5797:Gnmt UTSW 17 46726379 missense probably damaging 1.00
R7423:Gnmt UTSW 17 46726140 missense probably damaging 1.00
R7825:Gnmt UTSW 17 46729093 missense probably damaging 0.99
R8785:Gnmt UTSW 17 46727387 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-11-08