Incidental Mutation 'R0853:Ralyl'
ID82608
Institutional Source Beutler Lab
Gene Symbol Ralyl
Ensembl Gene ENSMUSG00000039717
Gene NameRALY RNA binding protein-like
Synonyms
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location13471655-14182287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13946506 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 4 (Y4C)
Ref Sequence ENSEMBL: ENSMUSP00000104009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108372] [ENSMUST00000171075] [ENSMUST00000192209] [ENSMUST00000193117] [ENSMUST00000211860]
Predicted Effect probably damaging
Transcript: ENSMUST00000108372
AA Change: Y4C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104009
Gene: ENSMUSG00000039717
AA Change: Y4C

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 182 N/A INTRINSIC
low complexity region 201 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171075
AA Change: Y4C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125848
Gene: ENSMUSG00000039717
AA Change: Y4C

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192209
AA Change: Y4C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142094
Gene: ENSMUSG00000039717
AA Change: Y4C

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193117
Predicted Effect probably benign
Transcript: ENSMUST00000211860
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Ralyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Ralyl APN 3 14107272 splice site probably benign
IGL02626:Ralyl APN 3 13777034 missense probably benign 0.00
IGL02950:Ralyl APN 3 14039721 missense probably damaging 1.00
PIT4498001:Ralyl UTSW 3 14107239 missense probably damaging 0.99
R1061:Ralyl UTSW 3 14115701 missense probably damaging 1.00
R1068:Ralyl UTSW 3 13776889 missense probably damaging 1.00
R1655:Ralyl UTSW 3 14107236 missense probably damaging 1.00
R1796:Ralyl UTSW 3 14143433 missense possibly damaging 0.77
R1838:Ralyl UTSW 3 14143412 missense probably damaging 1.00
R4706:Ralyl UTSW 3 14039790 critical splice donor site probably null
R5505:Ralyl UTSW 3 13776920 missense probably damaging 1.00
R5510:Ralyl UTSW 3 13776945 missense probably damaging 1.00
R6844:Ralyl UTSW 3 13776878 missense probably damaging 1.00
R6919:Ralyl UTSW 3 13777031 missense probably damaging 1.00
R7876:Ralyl UTSW 3 14039790 critical splice donor site probably null
R8297:Ralyl UTSW 3 14039776 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGAATGGTATTGCCCTGGCTTTCAC -3'
(R):5'- ACTGAGAAGTTTGGCAGGACATAGC -3'

Sequencing Primer
(F):5'- CACTGTGTGATTGCTGGTTACC -3'
(R):5'- CCCTGCATGAATGAAGGCTG -3'
Posted On2013-11-08