Incidental Mutation 'R0853:Tubgcp5'
ID82616
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55814851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
Predicted Effect probably benign
Transcript: ENSMUST00000032627
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205779
Predicted Effect probably benign
Transcript: ENSMUST00000205796
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55816562 missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAAATCCTGCTTGCTCTGGC -3'
(R):5'- TTCAGGACAGGCTTCAGGAAGGAC -3'

Sequencing Primer
(F):5'- tcattacgggtggttgtgag -3'
(R):5'- GCACTGTCACTCACTTTGTC -3'
Posted On2013-11-08