Incidental Mutation 'R0853:Kat8'
ID82617
Institutional Source Beutler Lab
Gene Symbol Kat8
Ensembl Gene ENSMUSG00000030801
Gene NameK(lysine) acetyltransferase 8
Synonyms5830450F21Rik, 2010203C02Rik, Myst1, MOF, D7Ertd629e
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127912516-127925837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127925224 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 425 (H425Y)
Ref Sequence ENSEMBL: ENSMUSP00000033070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000205357] [ENSMUST00000206124] [ENSMUST00000206568]
PDB Structure
Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033070
AA Change: H425Y

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801
AA Change: H425Y

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205357
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206364
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Meta Mutation Damage Score 0.2521 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele die prior to gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Kat8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Kat8 APN 7 127920504 missense probably damaging 1.00
R1293:Kat8 UTSW 7 127922250 critical splice donor site probably null
R1926:Kat8 UTSW 7 127915295 nonsense probably null
R3824:Kat8 UTSW 7 127924482 missense possibly damaging 0.56
R4841:Kat8 UTSW 7 127925194 missense probably benign 0.11
R4892:Kat8 UTSW 7 127915538 missense possibly damaging 0.68
R5102:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5104:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5722:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5723:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5724:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5734:Kat8 UTSW 7 127920579 missense probably benign 0.00
R5820:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5821:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R7059:Kat8 UTSW 7 127924903 missense probably benign
R7158:Kat8 UTSW 7 127922159 missense probably benign
X0027:Kat8 UTSW 7 127925258 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGGTCCAGAATACACTGTCC -3'
(R):5'- GTAACCACTTCTAGGCTGCCATCC -3'

Sequencing Primer
(F):5'- TCGCTTGGAACCCTAAAGG -3'
(R):5'- TAGGCTGCCATCCTAGAAACTG -3'
Posted On2013-11-08