Mutagenetix > Incidental Mutation

Incidental Mutation 'R0853:Rapgef6'

82624

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

039032-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0853 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54668677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1052 (I1052N)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

AlphaFold

Q5NCJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000094536
AA Change: I762N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I762N

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: I1047N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I1047N

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: I1047N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I1047N

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108894
AA Change: I762N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I762N

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: I1052N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9326

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.9%

Validation Efficiency

93% (42/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl1	G	T	9: 14,592,778	P378Q	probably damaging	Het
Angpt4	A	G	2: 151,938,927	E365G	probably damaging	Het
Asb6	G	A	2: 30,827,030	P61L	possibly damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atxn7	C	A	14: 14,089,465		probably benign	Het
Cacul1	A	T	19: 60,534,226	I290N	probably damaging	Het
Ccser2	A	C	14: 36,940,410	S272R	probably benign	Het
Cfh	T	A	1: 140,105,490	H772L	probably damaging	Het
Cldn6	T	G	17: 23,681,464	I134S	probably damaging	Het
Col3a1	T	A	1: 45,343,324		probably benign	Het
Fam118a	T	C	15: 85,048,525	F156S	possibly damaging	Het
Fgd4	T	A	16: 16,474,387		probably benign	Het
Gckr	G	C	5: 31,305,048	A242P	probably damaging	Het
Gcnt4	A	G	13: 96,946,835	D213G	probably damaging	Het
Gm21994	A	T	2: 150,255,478	S38R	probably benign	Het
Hace1	T	A	10: 45,648,683	V237E	probably damaging	Het
Herc3	T	C	6: 58,876,564	L570P	probably damaging	Het
Hk1	T	A	10: 62,271,716	K827*	probably null	Het
Hyal6	T	C	6: 24,734,073	F2L	probably benign	Het
Jak2	C	A	19: 29,284,926	Y382*	probably null	Het
Kat8	C	T	7: 127,925,224	H425Y	probably benign	Het
Kcnj3	T	C	2: 55,437,223	F8S	possibly damaging	Het
Klk1	T	A	7: 44,221,498		probably benign	Het
Klra8	T	C	6: 130,119,014	Y205C	probably damaging	Het
Kpnb1	T	C	11: 97,187,411	E26G	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nphp3	T	C	9: 104,031,933	S781P	probably benign	Het
Nqo2	A	T	13: 33,979,577	H73L	probably benign	Het
P3h3	G	T	6: 124,854,933	D296E	probably benign	Het
Pah	G	A	10: 87,576,218		probably null	Het
Pcdhb4	T	G	18: 37,309,885	Y749*	probably null	Het
Pdgfrb	C	A	18: 61,080,327	N914K	probably damaging	Het
Ralyl	A	G	3: 13,946,506	Y4C	probably damaging	Het
Sdk2	G	A	11: 113,821,415	T1642I	probably benign	Het
Siglec1	G	A	2: 131,085,022	T207M	probably damaging	Het
Taf1b	T	C	12: 24,514,828	L148P	probably benign	Het
Tbx20	A	G	9: 24,725,612	M393T	probably benign	Het
Tdp1	G	A	12: 99,935,067	R536H	probably damaging	Het
Tubgcp5	T	A	7: 55,814,851		probably benign	Het
Vezf1	A	T	11: 88,068,435		probably benign	Het
Vmn1r58	G	T	7: 5,410,325	T302K	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGTCAGGGCTGAACAGTCTATGAA -3'
(R):5'- AGGTTGACTATTGCTTACCTGTGAGGA -3'

Sequencing Primer
(F):5'- TTTATCAAGTCTTAAAAGGGAGTGGG -3'
(R):5'- CTTACCTGTGAGGATTACTGTAATG -3'

Posted On

2013-11-08