Mutagenetix > Incidental Mutations

Incidental Mutation 'R0853:Taf1b'

82629

Institutional Source

Beutler Lab

Gene Symbol

Taf1b

Ensembl Gene

ENSMUSG00000059669

Gene Name

TATA-box binding protein associated factor, RNA polymerase I, B

Synonyms

A230108M10Rik, mTAFI68, p63, 4930408G01Rik

MMRRC Submission

039032-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R0853 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24498359-24558539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24514828 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 148 (L148P)

Ref Sequence

ENSEMBL: ENSMUSP00000075339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]

Predicted Effect

probably benign
Transcript: ENSMUST00000075954
AA Change: L148P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: L148P

Domain	Start	End	E-Value	Type
Pfam:RRN7	3	39	7.3e-15	PFAM
low complexity region	141	153	N/A	INTRINSIC
low complexity region	361	374	N/A	INTRINSIC
low complexity region	411	425	N/A	INTRINSIC
low complexity region	574	583	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220562

Predicted Effect

probably benign
Transcript: ENSMUST00000221372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223503

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.9%

Validation Efficiency

93% (42/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl1	G	T	9: 14,592,778	P378Q	probably damaging	Het
Angpt4	A	G	2: 151,938,927	E365G	probably damaging	Het
Asb6	G	A	2: 30,827,030	P61L	possibly damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atxn7	C	A	14: 14,089,465		probably benign	Het
Cacul1	A	T	19: 60,534,226	I290N	probably damaging	Het
Ccser2	A	C	14: 36,940,410	S272R	probably benign	Het
Cfh	T	A	1: 140,105,490	H772L	probably damaging	Het
Cldn6	T	G	17: 23,681,464	I134S	probably damaging	Het
Col3a1	T	A	1: 45,343,324		probably benign	Het
Fam118a	T	C	15: 85,048,525	F156S	possibly damaging	Het
Fgd4	T	A	16: 16,474,387		probably benign	Het
Gckr	G	C	5: 31,305,048	A242P	probably damaging	Het
Gcnt4	A	G	13: 96,946,835	D213G	probably damaging	Het
Gm21994	A	T	2: 150,255,478	S38R	probably benign	Het
Hace1	T	A	10: 45,648,683	V237E	probably damaging	Het
Herc3	T	C	6: 58,876,564	L570P	probably damaging	Het
Hk1	T	A	10: 62,271,716	K827*	probably null	Het
Hyal6	T	C	6: 24,734,073	F2L	probably benign	Het
Jak2	C	A	19: 29,284,926	Y382*	probably null	Het
Kat8	C	T	7: 127,925,224	H425Y	probably benign	Het
Kcnj3	T	C	2: 55,437,223	F8S	possibly damaging	Het
Klk1	T	A	7: 44,221,498		probably benign	Het
Klra8	T	C	6: 130,119,014	Y205C	probably damaging	Het
Kpnb1	T	C	11: 97,187,411	E26G	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nphp3	T	C	9: 104,031,933	S781P	probably benign	Het
Nqo2	A	T	13: 33,979,577	H73L	probably benign	Het
P3h3	G	T	6: 124,854,933	D296E	probably benign	Het
Pah	G	A	10: 87,576,218		probably null	Het
Pcdhb4	T	G	18: 37,309,885	Y749*	probably null	Het
Pdgfrb	C	A	18: 61,080,327	N914K	probably damaging	Het
Ralyl	A	G	3: 13,946,506	Y4C	probably damaging	Het
Rapgef6	T	A	11: 54,668,677	I1052N	probably damaging	Het
Sdk2	G	A	11: 113,821,415	T1642I	probably benign	Het
Siglec1	G	A	2: 131,085,022	T207M	probably damaging	Het
Tbx20	A	G	9: 24,725,612	M393T	probably benign	Het
Tdp1	G	A	12: 99,935,067	R536H	probably damaging	Het
Tubgcp5	T	A	7: 55,814,851		probably benign	Het
Vezf1	A	T	11: 88,068,435		probably benign	Het
Vmn1r58	G	T	7: 5,410,325	T302K	probably damaging	Het

Other mutations in Taf1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Taf1b	APN	12	24547067	missense	possibly damaging	0.86
IGL01460:Taf1b	APN	12	24558246	missense	possibly damaging	0.96
IGL02100:Taf1b	APN	12	24544395	missense	possibly damaging	0.96
IGL02305:Taf1b	APN	12	24544271	missense	possibly damaging	0.73
IGL02729:Taf1b	APN	12	24547625	splice site	probably benign
PIT4283001:Taf1b	UTSW	12	24547595	missense	possibly damaging	0.86
PIT4519001:Taf1b	UTSW	12	24547119	nonsense	probably null
R0350:Taf1b	UTSW	12	24514885	missense	possibly damaging	0.85
R1023:Taf1b	UTSW	12	24509559	utr 3 prime	probably benign
R1604:Taf1b	UTSW	12	24556624	missense	probably benign
R1702:Taf1b	UTSW	12	24509126	missense	possibly damaging	0.73
R1743:Taf1b	UTSW	12	24547178	missense	possibly damaging	0.85
R1817:Taf1b	UTSW	12	24547122	missense	possibly damaging	0.70
R1873:Taf1b	UTSW	12	24556669	missense	possibly damaging	0.96
R4595:Taf1b	UTSW	12	24500442	missense	possibly damaging	0.85
R5280:Taf1b	UTSW	12	24549438	missense	probably benign	0.18
R5838:Taf1b	UTSW	12	24500449	missense	possibly damaging	0.92
R5849:Taf1b	UTSW	12	24500525	missense	probably damaging	1.00
R6368:Taf1b	UTSW	12	24558257	missense	possibly damaging	0.53
R6529:Taf1b	UTSW	12	24556651	missense	possibly damaging	0.53
R6589:Taf1b	UTSW	12	24556528	missense	possibly damaging	0.72
R6879:Taf1b	UTSW	12	24500517	missense	possibly damaging	0.71
R7342:Taf1b	UTSW	12	24558344	nonsense	probably null
R7449:Taf1b	UTSW	12	24504993	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- CGCAGAAAGGACTCTCAGATGCAC -3'
(R):5'- CTGAATGCCGCCTATGGCAGTAATAA -3'

Sequencing Primer
(F):5'- TGCACTGACAAGCAGTAGC -3'
(R):5'- gccagagaggaaaccagatac -3'

Posted On

2013-11-08