Incidental Mutation 'R0853:Taf1b'
ID82629
Institutional Source Beutler Lab
Gene Symbol Taf1b
Ensembl Gene ENSMUSG00000059669
Gene NameTATA-box binding protein associated factor, RNA polymerase I, B
SynonymsA230108M10Rik, mTAFI68, p63, 4930408G01Rik
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24498359-24558539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24514828 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 148 (L148P)
Ref Sequence ENSEMBL: ENSMUSP00000075339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]
Predicted Effect probably benign
Transcript: ENSMUST00000075954
AA Change: L148P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: L148P

DomainStartEndE-ValueType
Pfam:RRN7 3 39 7.3e-15 PFAM
low complexity region 141 153 N/A INTRINSIC
low complexity region 361 374 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
low complexity region 574 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220562
Predicted Effect probably benign
Transcript: ENSMUST00000221372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223503
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
Nqo2 A T 13: 33,979,577 H73L probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Taf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Taf1b APN 12 24547067 missense possibly damaging 0.86
IGL01460:Taf1b APN 12 24558246 missense possibly damaging 0.96
IGL02100:Taf1b APN 12 24544395 missense possibly damaging 0.96
IGL02305:Taf1b APN 12 24544271 missense possibly damaging 0.73
IGL02729:Taf1b APN 12 24547625 splice site probably benign
PIT4283001:Taf1b UTSW 12 24547595 missense possibly damaging 0.86
PIT4519001:Taf1b UTSW 12 24547119 nonsense probably null
R0350:Taf1b UTSW 12 24514885 missense possibly damaging 0.85
R1023:Taf1b UTSW 12 24509559 utr 3 prime probably benign
R1604:Taf1b UTSW 12 24556624 missense probably benign
R1702:Taf1b UTSW 12 24509126 missense possibly damaging 0.73
R1743:Taf1b UTSW 12 24547178 missense possibly damaging 0.85
R1817:Taf1b UTSW 12 24547122 missense possibly damaging 0.70
R1873:Taf1b UTSW 12 24556669 missense possibly damaging 0.96
R4595:Taf1b UTSW 12 24500442 missense possibly damaging 0.85
R5280:Taf1b UTSW 12 24549438 missense probably benign 0.18
R5838:Taf1b UTSW 12 24500449 missense possibly damaging 0.92
R5849:Taf1b UTSW 12 24500525 missense probably damaging 1.00
R6368:Taf1b UTSW 12 24558257 missense possibly damaging 0.53
R6529:Taf1b UTSW 12 24556651 missense possibly damaging 0.53
R6589:Taf1b UTSW 12 24556528 missense possibly damaging 0.72
R6879:Taf1b UTSW 12 24500517 missense possibly damaging 0.71
R7342:Taf1b UTSW 12 24558344 nonsense probably null
R7449:Taf1b UTSW 12 24504993 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CGCAGAAAGGACTCTCAGATGCAC -3'
(R):5'- CTGAATGCCGCCTATGGCAGTAATAA -3'

Sequencing Primer
(F):5'- TGCACTGACAAGCAGTAGC -3'
(R):5'- gccagagaggaaaccagatac -3'
Posted On2013-11-08