Incidental Mutation 'R0853:Nqo2'
ID82631
Institutional Source Beutler Lab
Gene Symbol Nqo2
Ensembl Gene ENSMUSG00000046949
Gene NameN-ribosyldihydronicotinamide quinone reductase 2
SynonymsNmor2, Ox-2, NRH: quinone oxidoreductase, Ox2
MMRRC Submission 039032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0853 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33964687-33988443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33979577 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 73 (H73L)
Ref Sequence ENSEMBL: ENSMUSP00000152598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]
Predicted Effect probably benign
Transcript: ENSMUST00000021843
AA Change: H73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: H73L

DomainStartEndE-ValueType
Pfam:FMN_red 4 159 5.6e-15 PFAM
Pfam:Flavodoxin_2 4 212 3.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058978
AA Change: H73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: H73L

DomainStartEndE-ValueType
Pfam:FMN_red 4 158 2e-14 PFAM
Pfam:Flavodoxin_2 4 212 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076532
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166354
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167597
Predicted Effect probably benign
Transcript: ENSMUST00000168400
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220844
AA Change: H29L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222740
AA Change: H73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223479
AA Change: H73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,592,778 P378Q probably damaging Het
Angpt4 A G 2: 151,938,927 E365G probably damaging Het
Asb6 G A 2: 30,827,030 P61L possibly damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atxn7 C A 14: 14,089,465 probably benign Het
Cacul1 A T 19: 60,534,226 I290N probably damaging Het
Ccser2 A C 14: 36,940,410 S272R probably benign Het
Cfh T A 1: 140,105,490 H772L probably damaging Het
Cldn6 T G 17: 23,681,464 I134S probably damaging Het
Col3a1 T A 1: 45,343,324 probably benign Het
Fam118a T C 15: 85,048,525 F156S possibly damaging Het
Fgd4 T A 16: 16,474,387 probably benign Het
Gckr G C 5: 31,305,048 A242P probably damaging Het
Gcnt4 A G 13: 96,946,835 D213G probably damaging Het
Gm21994 A T 2: 150,255,478 S38R probably benign Het
Hace1 T A 10: 45,648,683 V237E probably damaging Het
Herc3 T C 6: 58,876,564 L570P probably damaging Het
Hk1 T A 10: 62,271,716 K827* probably null Het
Hyal6 T C 6: 24,734,073 F2L probably benign Het
Jak2 C A 19: 29,284,926 Y382* probably null Het
Kat8 C T 7: 127,925,224 H425Y probably benign Het
Kcnj3 T C 2: 55,437,223 F8S possibly damaging Het
Klk1 T A 7: 44,221,498 probably benign Het
Klra8 T C 6: 130,119,014 Y205C probably damaging Het
Kpnb1 T C 11: 97,187,411 E26G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nphp3 T C 9: 104,031,933 S781P probably benign Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pah G A 10: 87,576,218 probably null Het
Pcdhb4 T G 18: 37,309,885 Y749* probably null Het
Pdgfrb C A 18: 61,080,327 N914K probably damaging Het
Ralyl A G 3: 13,946,506 Y4C probably damaging Het
Rapgef6 T A 11: 54,668,677 I1052N probably damaging Het
Sdk2 G A 11: 113,821,415 T1642I probably benign Het
Siglec1 G A 2: 131,085,022 T207M probably damaging Het
Taf1b T C 12: 24,514,828 L148P probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Tdp1 G A 12: 99,935,067 R536H probably damaging Het
Tubgcp5 T A 7: 55,814,851 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r58 G T 7: 5,410,325 T302K probably damaging Het
Other mutations in Nqo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Nqo2 APN 13 33985343 nonsense probably null
IGL02884:Nqo2 APN 13 33972361 missense probably damaging 1.00
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0848:Nqo2 UTSW 13 33972478 critical splice donor site probably null
R3417:Nqo2 UTSW 13 33979633 missense probably benign 0.01
R4110:Nqo2 UTSW 13 33979637 missense probably benign 0.00
R4936:Nqo2 UTSW 13 33981518 missense probably damaging 1.00
R5861:Nqo2 UTSW 13 33972430 missense probably damaging 1.00
R6161:Nqo2 UTSW 13 33979651 missense probably damaging 0.99
R6599:Nqo2 UTSW 13 33979556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGCTGAGCTTCTGGTCAATC -3'
(R):5'- TCTGGGACTACTGGGCCATGAATAC -3'

Sequencing Primer
(F):5'- TGGTCAATCCCAGAAAAATCCTAAGG -3'
(R):5'- CATGCTGACTTCAGGAGTGAG -3'
Posted On2013-11-08