Incidental Mutation 'R0853:Atxn7'
ID 82633
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms Sca7, A430107N12Rik, ataxin-7
MMRRC Submission 039032-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0853 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 8362461-8508323 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 14089465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect probably benign
Transcript: ENSMUST00000022257
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223714
Predicted Effect probably benign
Transcript: ENSMUST00000223880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224616
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.9%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G T 9: 14,504,074 (GRCm39) P378Q probably damaging Het
Angpt4 A G 2: 151,780,847 (GRCm39) E365G probably damaging Het
Asb6 G A 2: 30,717,042 (GRCm39) P61L possibly damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Cacul1 A T 19: 60,522,664 (GRCm39) I290N probably damaging Het
Ccser2 A C 14: 36,662,367 (GRCm39) S272R probably benign Het
Cfh T A 1: 140,033,228 (GRCm39) H772L probably damaging Het
Cldn6 T G 17: 23,900,438 (GRCm39) I134S probably damaging Het
Col3a1 T A 1: 45,382,484 (GRCm39) probably benign Het
Fam118a T C 15: 84,932,726 (GRCm39) F156S possibly damaging Het
Fgd4 T A 16: 16,292,251 (GRCm39) probably benign Het
Gckr G C 5: 31,462,392 (GRCm39) A242P probably damaging Het
Gcnt4 A G 13: 97,083,343 (GRCm39) D213G probably damaging Het
Hace1 T A 10: 45,524,779 (GRCm39) V237E probably damaging Het
Herc3 T C 6: 58,853,549 (GRCm39) L570P probably damaging Het
Hk1 T A 10: 62,107,495 (GRCm39) K827* probably null Het
Hyal6 T C 6: 24,734,072 (GRCm39) F2L probably benign Het
Jak2 C A 19: 29,262,326 (GRCm39) Y382* probably null Het
Kat8 C T 7: 127,524,396 (GRCm39) H425Y probably benign Het
Kcnj3 T C 2: 55,327,235 (GRCm39) F8S possibly damaging Het
Klk1 T A 7: 43,870,922 (GRCm39) probably benign Het
Klra8 T C 6: 130,095,977 (GRCm39) Y205C probably damaging Het
Kpnb1 T C 11: 97,078,237 (GRCm39) E26G probably damaging Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Nphp3 T C 9: 103,909,132 (GRCm39) S781P probably benign Het
Nqo2 A T 13: 34,163,560 (GRCm39) H73L probably benign Het
P3h3 G T 6: 124,831,896 (GRCm39) D296E probably benign Het
Pah G A 10: 87,412,080 (GRCm39) probably null Het
Pcdhb4 T G 18: 37,442,938 (GRCm39) Y749* probably null Het
Pdgfrb C A 18: 61,213,399 (GRCm39) N914K probably damaging Het
Ralyl A G 3: 14,011,566 (GRCm39) Y4C probably damaging Het
Rapgef6 T A 11: 54,559,503 (GRCm39) I1052N probably damaging Het
Sdk2 G A 11: 113,712,241 (GRCm39) T1642I probably benign Het
Siglec1 G A 2: 130,926,942 (GRCm39) T207M probably damaging Het
Taf1b T C 12: 24,564,827 (GRCm39) L148P probably benign Het
Tbx20 A G 9: 24,636,908 (GRCm39) M393T probably benign Het
Tdp1 G A 12: 99,901,326 (GRCm39) R536H probably damaging Het
Tubgcp5 T A 7: 55,464,599 (GRCm39) probably benign Het
Vezf1 A T 11: 88,068,435 (GRCm38) probably benign Het
Vmn1r58 G T 7: 5,413,324 (GRCm39) T302K probably damaging Het
Zfp1002 A T 2: 150,097,398 (GRCm39) S38R probably benign Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14,096,324 (GRCm38) splice site probably benign
IGL00782:Atxn7 APN 14 14,096,218 (GRCm38) missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14,100,105 (GRCm38) missense probably benign 0.00
IGL02828:Atxn7 APN 14 14,090,056 (GRCm38) missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14,100,734 (GRCm38) missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14,052,994 (GRCm38) missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14,100,564 (GRCm38) missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14,087,273 (GRCm38) splice site probably benign
Estes_park UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
Lumpy UTSW 14 14,089,446 (GRCm38) nonsense probably null
Oestes_park UTSW 14 14,096,268 (GRCm38) nonsense probably null
R0034:Atxn7 UTSW 14 14,100,846 (GRCm38) missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14,100,317 (GRCm38) missense probably damaging 1.00
R1169:Atxn7 UTSW 14 14,095,468 (GRCm38) missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14,096,239 (GRCm38) missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14,089,419 (GRCm38) missense probably benign 0.25
R2078:Atxn7 UTSW 14 14,052,975 (GRCm38) missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14,013,268 (GRCm38) missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14,100,237 (GRCm38) missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14,100,308 (GRCm38) missense probably benign 0.00
R4230:Atxn7 UTSW 14 14,100,381 (GRCm38) missense probably benign 0.00
R4588:Atxn7 UTSW 14 14,096,268 (GRCm38) nonsense probably null
R4688:Atxn7 UTSW 14 14,089,288 (GRCm38) missense probably benign 0.00
R4935:Atxn7 UTSW 14 14,100,401 (GRCm38) missense probably benign
R5041:Atxn7 UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
R5185:Atxn7 UTSW 14 14,090,063 (GRCm38) missense probably benign 0.04
R5561:Atxn7 UTSW 14 14,089,260 (GRCm38) missense probably benign 0.19
R5641:Atxn7 UTSW 14 14,013,638 (GRCm38) missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14,089,446 (GRCm38) nonsense probably null
R6549:Atxn7 UTSW 14 14,013,087 (GRCm38) missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14,099,972 (GRCm38) missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14,095,511 (GRCm38) missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14,100,878 (GRCm38) missense probably benign 0.08
R7402:Atxn7 UTSW 14 14,095,427 (GRCm38) missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14,100,467 (GRCm38) missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14,013,635 (GRCm38) missense probably benign 0.06
R8786:Atxn7 UTSW 14 14,103,316 (GRCm38) missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14,089,441 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCAAGCCTGGCCTTAACTGTC -3'
(R):5'- CAGATCAATGACCCCACAGTGGATG -3'

Sequencing Primer
(F):5'- GGCCTTAACTGTCCCTCAATAC -3'
(R):5'- gccaggttcaggaagcag -3'
Posted On 2013-11-08