Incidental Mutation 'R0854:Pask'
ID82644
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene NamePAS domain containing serine/threonine kinase
SynonymsPaskin
MMRRC Submission 039033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0854 (G1)
Quality Score172
Status Not validated
Chromosome1
Chromosomal Location93308770-93343482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93327412 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 312 (K312R)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
Predicted Effect probably damaging
Transcript: ENSMUST00000027493
AA Change: K312R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: K312R

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139028
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12b G A 11: 69,164,476 probably null Het
Brox T G 1: 183,287,758 R128S possibly damaging Het
Cfap57 G A 4: 118,561,872 T1153I probably benign Het
Ddt C T 10: 75,771,495 R54H probably benign Het
Epm2aip1 T A 9: 111,272,499 L180* probably null Het
Fer1l6 A G 15: 58,559,188 I231V probably benign Het
Gng7 A G 10: 80,951,673 V52A possibly damaging Het
Hbb-bh2 T C 7: 103,840,065 H93R probably damaging Het
Muc4 A T 16: 32,778,955 H3292L possibly damaging Het
Mybpc2 T C 7: 44,517,002 E188G probably benign Het
Myh4 T C 11: 67,259,147 L1844P possibly damaging Het
Ncan G T 8: 70,112,552 R242S probably damaging Het
Nceh1 T A 3: 27,241,319 L243Q probably damaging Het
Notch4 T A 17: 34,568,572 S369T probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Sec24c A G 14: 20,689,340 Y40C probably damaging Het
Sema6d C T 2: 124,665,302 T1010M probably damaging Het
Thsd1 G A 8: 22,258,571 G433E probably damaging Het
Tnfsf18 T A 1: 161,503,668 I129N probably damaging Het
Tsc22d1 C T 14: 76,418,201 Q625* probably null Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r58 T G 7: 41,837,138 N778H probably damaging Het
Wdr17 C T 8: 54,703,881 V7I probably benign Het
Zranb1 T C 7: 132,949,848 V102A possibly damaging Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93310852 missense probably benign 0.02
IGL01620:Pask APN 1 93310122 missense possibly damaging 0.87
IGL01959:Pask APN 1 93334607 missense probably benign 0.03
IGL02170:Pask APN 1 93310884 missense possibly damaging 0.69
IGL02499:Pask APN 1 93321095 nonsense probably null
IGL02670:Pask APN 1 93310818 missense probably damaging 1.00
IGL03066:Pask APN 1 93330866 missense probably benign 0.02
IGL03210:Pask APN 1 93319992 missense possibly damaging 0.92
R0472:Pask UTSW 1 93320917 missense probably benign 0.00
R0524:Pask UTSW 1 93310834 missense probably damaging 1.00
R0854:Pask UTSW 1 93327400 missense probably damaging 0.99
R0854:Pask UTSW 1 93327434 missense possibly damaging 0.79
R0863:Pask UTSW 1 93314339 missense probably damaging 1.00
R1052:Pask UTSW 1 93330827 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1406:Pask UTSW 1 93321651 missense probably benign 0.00
R1831:Pask UTSW 1 93320769 splice site probably null
R1958:Pask UTSW 1 93321458 missense probably benign 0.00
R2143:Pask UTSW 1 93321297 missense probably benign 0.00
R2144:Pask UTSW 1 93321297 missense probably benign 0.00
R2145:Pask UTSW 1 93321297 missense probably benign 0.00
R2509:Pask UTSW 1 93330763 missense possibly damaging 0.62
R2858:Pask UTSW 1 93321651 missense probably benign 0.00
R2899:Pask UTSW 1 93334547 missense probably damaging 1.00
R3545:Pask UTSW 1 93317115 missense probably damaging 1.00
R3778:Pask UTSW 1 93327467 missense probably damaging 1.00
R4111:Pask UTSW 1 93310818 missense probably damaging 1.00
R4514:Pask UTSW 1 93322133 missense probably benign 0.03
R4527:Pask UTSW 1 93320502 missense probably benign
R4580:Pask UTSW 1 93322108 missense probably benign 0.36
R4718:Pask UTSW 1 93322196 missense possibly damaging 0.67
R4775:Pask UTSW 1 93337524 missense probably damaging 0.97
R5036:Pask UTSW 1 93322079 nonsense probably null
R5070:Pask UTSW 1 93330874 missense probably damaging 1.00
R5084:Pask UTSW 1 93322097 missense probably benign
R5151:Pask UTSW 1 93334628 missense probably damaging 1.00
R5196:Pask UTSW 1 93310083 unclassified probably benign
R5643:Pask UTSW 1 93337343 critical splice donor site probably null
R5739:Pask UTSW 1 93322056 missense probably benign
R6126:Pask UTSW 1 93314359 missense probably damaging 1.00
R7161:Pask UTSW 1 93310905 missense probably benign
R7284:Pask UTSW 1 93320669 missense probably benign 0.01
R7289:Pask UTSW 1 93331587 missense probably damaging 1.00
R8277:Pask UTSW 1 93325363 critical splice donor site probably null
R8303:Pask UTSW 1 93320564 missense probably benign 0.10
R8309:Pask UTSW 1 93312851 nonsense probably null
R8321:Pask UTSW 1 93320655 missense possibly damaging 0.85
Z1088:Pask UTSW 1 93316801 missense probably damaging 1.00
Z1177:Pask UTSW 1 93335732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGTGTGGCCCAGGGAAATG -3'
(R):5'- TGGCACAGATGCCTACTAGGGATG -3'

Sequencing Primer
(F):5'- CTCTGACGAATGCAGAATGGTTTC -3'
(R):5'- CAATTGCCAAGGTTCCAAATTC -3'
Posted On2013-11-08