Incidental Mutation 'R0854:Vezf1'
ID82665
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission 039033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0854 (G1)
Quality Score121
Status Not validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to T at 88068435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521]
Predicted Effect probably benign
Transcript: ENSMUST00000018521
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156149
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12b G A 11: 69,164,476 probably null Het
Brox T G 1: 183,287,758 R128S possibly damaging Het
Cfap57 G A 4: 118,561,872 T1153I probably benign Het
Ddt C T 10: 75,771,495 R54H probably benign Het
Epm2aip1 T A 9: 111,272,499 L180* probably null Het
Fer1l6 A G 15: 58,559,188 I231V probably benign Het
Gng7 A G 10: 80,951,673 V52A possibly damaging Het
Hbb-bh2 T C 7: 103,840,065 H93R probably damaging Het
Muc4 A T 16: 32,778,955 H3292L possibly damaging Het
Mybpc2 T C 7: 44,517,002 E188G probably benign Het
Myh4 T C 11: 67,259,147 L1844P possibly damaging Het
Ncan G T 8: 70,112,552 R242S probably damaging Het
Nceh1 T A 3: 27,241,319 L243Q probably damaging Het
Notch4 T A 17: 34,568,572 S369T probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Pask T A 1: 93,327,400 K316M probably damaging Het
Pask T C 1: 93,327,412 K312R probably damaging Het
Pask T A 1: 93,327,434 T305S possibly damaging Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Sec24c A G 14: 20,689,340 Y40C probably damaging Het
Sema6d C T 2: 124,665,302 T1010M probably damaging Het
Thsd1 G A 8: 22,258,571 G433E probably damaging Het
Tnfsf18 T A 1: 161,503,668 I129N probably damaging Het
Tsc22d1 C T 14: 76,418,201 Q625* probably null Het
Vmn2r58 T G 7: 41,837,138 N778H probably damaging Het
Wdr17 C T 8: 54,703,881 V7I probably benign Het
Zranb1 T C 7: 132,949,848 V102A possibly damaging Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0592:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0725:Vezf1 UTSW 11 88073330 missense probably benign 0.04
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0853:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6452:Vezf1 UTSW 11 88081670 missense possibly damaging 0.66
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
R7443:Vezf1 UTSW 11 88074663 missense probably damaging 1.00
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCCCGGAGGTTACCGGAAGTGG -3'
(R):5'- TGGCGGCGAAGCCAGAGATACC -3'

Sequencing Primer
(F):5'- GCTGCCATGTTGAGGAgc -3'
(R):5'- AGGGTCAGAAAGTCAACACAC -3'
Posted On2013-11-08