Incidental Mutation 'R0855:Blzf1'
ID82675
Institutional Source Beutler Lab
Gene Symbol Blzf1
Ensembl Gene ENSMUSG00000026577
Gene Namebasic leucine zipper nuclear factor 1
SynonymsJem-1, Golgin-45, 1700030G05Rik, Blzf1l
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164289800-164307489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164292381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000083196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027866] [ENSMUST00000027867] [ENSMUST00000086032] [ENSMUST00000120447]
Predicted Effect probably benign
Transcript: ENSMUST00000027866
AA Change: T360A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027866
Gene: ENSMUSG00000026577
AA Change: T360A

DomainStartEndE-ValueType
coiled coil region 130 175 N/A INTRINSIC
Pfam:DASH_Hsk3 191 236 2.9e-13 PFAM
coiled coil region 243 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027867
SMART Domains Protein: ENSMUSP00000027867
Gene: ENSMUSG00000026578

DomainStartEndE-ValueType
low complexity region 116 122 N/A INTRINSIC
coiled coil region 334 378 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086032
AA Change: T353A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083196
Gene: ENSMUSG00000026577
AA Change: T353A

DomainStartEndE-ValueType
coiled coil region 123 168 N/A INTRINSIC
Pfam:DASH_Hsk3 184 230 2.6e-18 PFAM
coiled coil region 236 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120447
AA Change: T353A

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113479
Gene: ENSMUSG00000026577
AA Change: T353A

DomainStartEndE-ValueType
coiled coil region 123 168 N/A INTRINSIC
Pfam:DASH_Hsk3 184 230 2.6e-18 PFAM
coiled coil region 236 269 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Blzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Blzf1 APN 1 164303930 unclassified probably benign
IGL01445:Blzf1 APN 1 164302620 missense possibly damaging 0.72
IGL02448:Blzf1 APN 1 164295781 missense possibly damaging 0.63
FR4737:Blzf1 UTSW 1 164303917 frame shift probably null
R1070:Blzf1 UTSW 1 164303930 unclassified probably benign
R1225:Blzf1 UTSW 1 164299596 missense probably damaging 1.00
R4660:Blzf1 UTSW 1 164306493 intron probably benign
R5047:Blzf1 UTSW 1 164306468 missense possibly damaging 0.50
R5552:Blzf1 UTSW 1 164302489 missense probably damaging 1.00
R5641:Blzf1 UTSW 1 164306469 missense probably benign 0.01
R6677:Blzf1 UTSW 1 164302612 missense possibly damaging 0.86
R7085:Blzf1 UTSW 1 164302324 missense probably damaging 1.00
R7233:Blzf1 UTSW 1 164295943 splice site probably null
R7293:Blzf1 UTSW 1 164295883 missense possibly damaging 0.91
R7801:Blzf1 UTSW 1 164295909 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTGAGCATGGCTCCAACAGACTAC -3'
(R):5'- CTGCTTTGAGTCTCAGGAGAGGAAAC -3'

Sequencing Primer
(F):5'- GACTACACACTAAAGAGCAATGAG -3'
(R):5'- CAGAAGAATGGAGGTCTGATTCTTAC -3'
Posted On2013-11-08