Incidental Mutation 'R0855:Sars'
ID82681
Institutional Source Beutler Lab
Gene Symbol Sars
Ensembl Gene ENSMUSG00000068739
Gene Nameseryl-aminoacyl-tRNA synthetase
SynonymsStrs
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108424865-108445209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108426932 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 503 (E503D)
Ref Sequence ENSEMBL: ENSMUSP00000099685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090553] [ENSMUST00000102625] [ENSMUST00000132467] [ENSMUST00000153499]
Predicted Effect probably benign
Transcript: ENSMUST00000090553
AA Change: E479D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088041
Gene: ENSMUSG00000068739
AA Change: E479D

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-20 PFAM
Pfam:tRNA-synt_2b 203 386 4.1e-39 PFAM
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102625
AA Change: E503D

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099685
Gene: ENSMUSG00000068739
AA Change: E503D

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.3e-22 PFAM
Pfam:tRNA-synt_2b 248 427 2.1e-41 PFAM
low complexity region 505 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132467
SMART Domains Protein: ENSMUSP00000120879
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 6.1e-23 PFAM
Pfam:tRNA-synt_2b 155 338 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153499
SMART Domains Protein: ENSMUSP00000118676
Gene: ENSMUSG00000068739

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 2 113 1.5e-23 PFAM
PDB:3VBB|F 150 187 3e-18 PDB
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Sars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Sars APN 3 108426858 missense probably damaging 0.99
IGL02898:Sars APN 3 108429263 missense probably damaging 1.00
R0660:Sars UTSW 3 108431473 missense probably damaging 1.00
R0749:Sars UTSW 3 108428266 missense possibly damaging 0.95
R1249:Sars UTSW 3 108435935 missense probably benign 0.14
R1540:Sars UTSW 3 108433145 missense probably benign 0.01
R1659:Sars UTSW 3 108429416 missense probably damaging 1.00
R1836:Sars UTSW 3 108435944 missense probably benign 0.00
R2120:Sars UTSW 3 108434156 missense probably benign 0.00
R3104:Sars UTSW 3 108429305 missense probably damaging 1.00
R3105:Sars UTSW 3 108429305 missense probably damaging 1.00
R6282:Sars UTSW 3 108428274 nonsense probably null
R7224:Sars UTSW 3 108428203 missense probably damaging 1.00
R7706:Sars UTSW 3 108431464 critical splice donor site probably null
R8219:Sars UTSW 3 108445062 missense probably benign 0.02
R8353:Sars UTSW 3 108428713 missense probably benign 0.14
R8398:Sars UTSW 3 108428173 critical splice donor site probably null
R8453:Sars UTSW 3 108428713 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCACCAGTCATCAGTGAAGAGACCC -3'
(R):5'- GGTGTCATATGCAGCTCCTAACCTC -3'

Sequencing Primer
(F):5'- AAGGGAACACCTGCTCTGTC -3'
(R):5'- AGCTCCTAACCTCAGAGTGG -3'
Posted On2013-11-08