Incidental Mutation 'R0855:Ndufaf6'
ID82682
Institutional Source Beutler Lab
Gene Symbol Ndufaf6
Ensembl Gene ENSMUSG00000050323
Gene NameNADH dehydrogenase (ubiquinone) complex I, assembly factor 6
Synonyms2310030N02Rik
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11051045-11076205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11051169 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 310 (H310Q)
Ref Sequence ENSEMBL: ENSMUSP00000062039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058183]
Predicted Effect probably damaging
Transcript: ENSMUST00000058183
AA Change: H310Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062039
Gene: ENSMUSG00000050323
AA Change: H310Q

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
Pfam:SQS_PSY 65 323 3.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144475
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to mitochondria and contains a predicted phytoene synthase domain. The encoded protein plays an important role in the assembly of complex I (NADH-ubiquinone oxidoreductase) of the mitochondrial respiratory chain through regulation of subunit ND1 biogenesis. Mutations in this gene are associated with complex I enzymatic deficiency. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Ndufaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ndufaf6 APN 4 11062127 missense probably damaging 1.00
IGL01325:Ndufaf6 APN 4 11070251 missense probably benign 0.00
IGL02524:Ndufaf6 APN 4 11059091 missense probably benign 0.10
PIT4366001:Ndufaf6 UTSW 4 11073215 missense probably benign 0.00
R0605:Ndufaf6 UTSW 4 11051224 missense probably damaging 0.99
R1674:Ndufaf6 UTSW 4 11070264 missense probably benign 0.04
R1857:Ndufaf6 UTSW 4 11053474 missense probably benign 0.00
R1858:Ndufaf6 UTSW 4 11053474 missense probably benign 0.00
R1859:Ndufaf6 UTSW 4 11053474 missense probably benign 0.00
R2174:Ndufaf6 UTSW 4 11070228 missense probably benign 0.00
R4651:Ndufaf6 UTSW 4 11062070 missense probably damaging 1.00
R4870:Ndufaf6 UTSW 4 11060917 missense probably benign 0.01
R5131:Ndufaf6 UTSW 4 11060931 missense probably damaging 0.99
R5929:Ndufaf6 UTSW 4 11051150 missense probably benign 0.00
R8253:Ndufaf6 UTSW 4 11059086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTTAACCCGAGCAACAGTG -3'
(R):5'- TCAACAGAGGCCCGGTGTTCATAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- gcagttctcctgtttcaatttcc -3'
Posted On2013-11-08