Incidental Mutation 'R0855:Cnksr1'
ID82684
Institutional Source Beutler Lab
Gene Symbol Cnksr1
Ensembl Gene ENSMUSG00000028841
Gene Nameconnector enhancer of kinase suppressor of Ras 1
Synonyms
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134228041-134238399 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 134233066 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030645]
Predicted Effect probably benign
Transcript: ENSMUST00000030645
SMART Domains Protein: ENSMUSP00000030645
Gene: ENSMUSG00000028841

DomainStartEndE-ValueType
SAM 4 70 1.44e-9 SMART
Pfam:CRIC_ras_sig 78 162 4.2e-26 PFAM
PDZ 206 276 1.48e-3 SMART
low complexity region 285 303 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PH 388 488 4.38e-19 SMART
coiled coil region 596 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146283
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several motifs involved in protein-protein interaction, including PDZ, PH (Pleckstrin homology), and SAM (sterile alpha motif) domains. The encoded protein acts as a scaffold component for receptor tyrosine kinase signaling and may mediate crosstalk between different signaling pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Cnksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Cnksr1 APN 4 134234701 missense probably benign 0.39
IGL01311:Cnksr1 APN 4 134230466 missense probably damaging 1.00
IGL01872:Cnksr1 APN 4 134228964 missense probably benign 0.13
IGL02082:Cnksr1 APN 4 134236052 missense probably damaging 1.00
IGL02405:Cnksr1 APN 4 134236281 missense possibly damaging 0.88
IGL02669:Cnksr1 APN 4 134230463 missense probably damaging 0.98
IGL02948:Cnksr1 APN 4 134235106 splice site probably null
IGL03037:Cnksr1 APN 4 134235106 splice site probably null
IGL03381:Cnksr1 APN 4 134232171 missense probably damaging 0.99
R1958:Cnksr1 UTSW 4 134228416 missense probably benign 0.02
R2049:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2140:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2141:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2142:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2389:Cnksr1 UTSW 4 134233746 missense probably benign 0.03
R2495:Cnksr1 UTSW 4 134232162 missense probably benign 0.00
R4596:Cnksr1 UTSW 4 134233878 missense possibly damaging 0.90
R4668:Cnksr1 UTSW 4 134232971 intron probably benign
R4896:Cnksr1 UTSW 4 134229675 splice site probably null
R5367:Cnksr1 UTSW 4 134230214 missense possibly damaging 0.94
R5673:Cnksr1 UTSW 4 134235188 missense probably damaging 1.00
R5844:Cnksr1 UTSW 4 134228264 unclassified probably benign
R6153:Cnksr1 UTSW 4 134233893 missense probably damaging 1.00
R7207:Cnksr1 UTSW 4 134235123 missense possibly damaging 0.75
R7261:Cnksr1 UTSW 4 134235773 splice site probably null
R7978:Cnksr1 UTSW 4 134236031 missense probably damaging 1.00
R8310:Cnksr1 UTSW 4 134229419 missense probably damaging 1.00
Z1176:Cnksr1 UTSW 4 134232135 missense probably damaging 1.00
Z1177:Cnksr1 UTSW 4 134232150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAAGGATGGGACTCTGAAAAGACC -3'
(R):5'- GAAGAAGATTCCCGTGCCAGAGAC -3'

Sequencing Primer
(F):5'- ATCCATGAGTTTAGGCCCAG -3'
(R):5'- ACACACATCTGCTTTCAGACTC -3'
Posted On2013-11-08