Incidental Mutation 'R0855:Cd38'
ID82686
Institutional Source Beutler Lab
Gene Symbol Cd38
Ensembl Gene ENSMUSG00000029084
Gene NameCD38 antigen
SynonymsCd38-rs1
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43868553-43912375 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 43903585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030964]
PDB Structure
Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030964
SMART Domains Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Rib_hydrolayse 59 300 2.9e-104 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Cd38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Cd38 APN 5 43903597 missense probably benign 0.04
IGL01691:Cd38 APN 5 43903586 splice site probably benign
IGL02585:Cd38 APN 5 43910302 missense probably damaging 1.00
paradiso UTSW 5 43903585 splice site probably null
IGL02796:Cd38 UTSW 5 43906213 missense probably damaging 1.00
R0496:Cd38 UTSW 5 43868891 missense probably damaging 1.00
R1621:Cd38 UTSW 5 43901524 missense probably benign 0.00
R2353:Cd38 UTSW 5 43908011 critical splice donor site probably null
R2366:Cd38 UTSW 5 43903590 splice site probably benign
R2860:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R2861:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R4342:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4343:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4344:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4953:Cd38 UTSW 5 43907545 missense possibly damaging 0.73
R5007:Cd38 UTSW 5 43906164 missense probably damaging 1.00
R5371:Cd38 UTSW 5 43868883 missense probably benign 0.01
R5699:Cd38 UTSW 5 43900386 missense probably damaging 1.00
R6857:Cd38 UTSW 5 43906198 missense probably damaging 0.99
R6945:Cd38 UTSW 5 43908006 missense probably damaging 1.00
R7129:Cd38 UTSW 5 43910309 missense probably benign 0.13
R7825:Cd38 UTSW 5 43901455 missense probably damaging 1.00
R7852:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7855:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7894:Cd38 UTSW 5 43900404 missense probably damaging 1.00
R8133:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R8134:Cd38 UTSW 5 43901448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAATGGTGAGTCAAAACCC -3'
(R):5'- ACACAGCCAGTGAGTGTTACCTCC -3'

Sequencing Primer
(F):5'- AACCCATCACAGTGTTCCTG -3'
(R):5'- ACCTCCTCACTGGGTTAGG -3'
Posted On2013-11-08