Incidental Mutation 'R0855:Impdh1'
ID82687
Institutional Source Beutler Lab
Gene Symbol Impdh1
Ensembl Gene ENSMUSG00000003500
Gene Nameinosine monophosphate dehydrogenase 1
Synonyms
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29200434-29216364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29206972 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 116 (H116L)
Ref Sequence ENSEMBL: ENSMUSP00000125077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078155] [ENSMUST00000159124] [ENSMUST00000160749] [ENSMUST00000160878] [ENSMUST00000162099] [ENSMUST00000162215] [ENSMUST00000162739]
Predicted Effect probably damaging
Transcript: ENSMUST00000078155
AA Change: H92L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077289
Gene: ENSMUSG00000003500
AA Change: H92L

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159124
AA Change: H92L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124931
Gene: ENSMUSG00000003500
AA Change: H92L

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160613
Predicted Effect probably benign
Transcript: ENSMUST00000160749
SMART Domains Protein: ENSMUSP00000125488
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
Pfam:IMPDH 28 84 3.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160878
SMART Domains Protein: ENSMUSP00000124269
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 28 479 2.97e-232 SMART
CBS 92 143 6.49e-10 SMART
CBS 159 207 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161654
Predicted Effect probably damaging
Transcript: ENSMUST00000162099
AA Change: H92L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124541
Gene: ENSMUSG00000003500
AA Change: H92L

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162215
AA Change: H92L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125235
Gene: ENSMUSG00000003500
AA Change: H92L

DomainStartEndE-ValueType
IMPDH 28 231 5.75e-17 SMART
CBS 161 209 3.37e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162242
SMART Domains Protein: ENSMUSP00000123981
Gene: ENSMUSG00000003500

DomainStartEndE-ValueType
IMPDH 1 145 2e-11 SMART
low complexity region 165 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162739
AA Change: H116L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125077
Gene: ENSMUSG00000003500
AA Change: H116L

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
IMPDH 86 558 2e-256 SMART
CBS 171 222 6.49e-10 SMART
CBS 238 286 3.37e-8 SMART
Meta Mutation Damage Score 0.9650 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Impdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Impdh1 APN 6 29203378 missense probably damaging 0.97
IGL01642:Impdh1 APN 6 29207166 missense possibly damaging 0.57
IGL02187:Impdh1 APN 6 29207087 splice site probably benign
IGL02294:Impdh1 APN 6 29205202 missense probably benign 0.19
IGL02570:Impdh1 APN 6 29203198 missense probably damaging 1.00
IGL02858:Impdh1 APN 6 29206925 nonsense probably null
IGL02874:Impdh1 APN 6 29203156 missense probably damaging 1.00
steve UTSW 6 29204632 nonsense probably null
R0089:Impdh1 UTSW 6 29206326 missense probably benign
R1331:Impdh1 UTSW 6 29206478 missense probably damaging 0.96
R1797:Impdh1 UTSW 6 29207169 missense probably damaging 0.98
R1824:Impdh1 UTSW 6 29205088 missense probably benign 0.08
R1981:Impdh1 UTSW 6 29206451 missense possibly damaging 0.70
R2076:Impdh1 UTSW 6 29205163 missense probably damaging 0.99
R3841:Impdh1 UTSW 6 29202769 missense probably damaging 0.98
R4020:Impdh1 UTSW 6 29202694 missense probably benign 0.01
R4415:Impdh1 UTSW 6 29209222 missense probably damaging 1.00
R4471:Impdh1 UTSW 6 29204632 nonsense probably null
R4777:Impdh1 UTSW 6 29205202 missense possibly damaging 0.95
R5783:Impdh1 UTSW 6 29206343 missense possibly damaging 0.66
R5973:Impdh1 UTSW 6 29207162 missense probably damaging 1.00
R7230:Impdh1 UTSW 6 29206063 splice site probably null
R7512:Impdh1 UTSW 6 29207169 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AACCCAAAGGTGGCACATAGCCTG -3'
(R):5'- TGACCCGGAAGATCACACTGAAGAC -3'

Sequencing Primer
(F):5'- CCATTGAGAAGTGAGAGTCCTC -3'
(R):5'- TGAAGACACCATTGATCTCGTC -3'
Posted On2013-11-08