Incidental Mutation 'R0855:Picalm'
ID82690
Institutional Source Beutler Lab
Gene Symbol Picalm
Ensembl Gene ENSMUSG00000039361
Gene Namephosphatidylinositol binding clathrin assembly protein
Synonymsfit-1, fit1
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90130213-90213465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90191148 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 458 (D458E)
Ref Sequence ENSEMBL: ENSMUSP00000146386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000049537] [ENSMUST00000207084] [ENSMUST00000207084] [ENSMUST00000207225] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000208730] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000209068]
Predicted Effect probably benign
Transcript: ENSMUST00000049537
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049537
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207084
Predicted Effect probably benign
Transcript: ENSMUST00000207084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207106
Predicted Effect probably benign
Transcript: ENSMUST00000207225
Predicted Effect probably benign
Transcript: ENSMUST00000207225
Predicted Effect possibly damaging
Transcript: ENSMUST00000207484
AA Change: D508E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207822
Predicted Effect unknown
Transcript: ENSMUST00000208089
AA Change: D233E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208127
Predicted Effect probably benign
Transcript: ENSMUST00000208730
Predicted Effect probably benign
Transcript: ENSMUST00000208730
Predicted Effect possibly damaging
Transcript: ENSMUST00000208742
AA Change: D508E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208891
Predicted Effect possibly damaging
Transcript: ENSMUST00000209068
AA Change: D458E

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Picalm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Picalm APN 7 90161318 missense probably damaging 1.00
IGL01147:Picalm APN 7 90177592 missense probably benign 0.42
IGL02814:Picalm APN 7 90191749 missense possibly damaging 0.75
IGL02828:Picalm APN 7 90177501 missense probably benign
IGL02904:Picalm APN 7 90176411 splice site probably benign
IGL02986:Picalm APN 7 90207585 missense probably benign 0.00
IGL03001:Picalm APN 7 90182246 missense probably benign 0.00
IGL03247:Picalm APN 7 90194291 missense probably benign 0.27
R0024:Picalm UTSW 7 90130704 critical splice donor site probably null
R0085:Picalm UTSW 7 90182317 missense probably benign
R0414:Picalm UTSW 7 90189198 missense possibly damaging 0.94
R0537:Picalm UTSW 7 90130668 missense probably benign 0.05
R1269:Picalm UTSW 7 90165549 nonsense probably null
R1496:Picalm UTSW 7 90130651 missense probably benign 0.36
R1635:Picalm UTSW 7 90191251 missense probably damaging 1.00
R1750:Picalm UTSW 7 90191182 missense possibly damaging 0.81
R1755:Picalm UTSW 7 90160549 missense possibly damaging 0.88
R2513:Picalm UTSW 7 90197009 missense probably damaging 1.00
R3850:Picalm UTSW 7 90191704 missense probably damaging 1.00
R3874:Picalm UTSW 7 90189219 missense probably damaging 1.00
R5095:Picalm UTSW 7 90170633 missense probably damaging 1.00
R5368:Picalm UTSW 7 90207595 makesense probably null
R5517:Picalm UTSW 7 90170598 missense possibly damaging 0.68
R6012:Picalm UTSW 7 90195700 missense probably benign
R6280:Picalm UTSW 7 90177562 missense probably benign 0.00
R6739:Picalm UTSW 7 90176708 missense probably damaging 1.00
R6951:Picalm UTSW 7 90191375 missense probably damaging 1.00
R7083:Picalm UTSW 7 90176768 missense probably benign 0.01
R7877:Picalm UTSW 7 90130668 missense probably benign 0.05
R8081:Picalm UTSW 7 90191243 nonsense probably null
Z1176:Picalm UTSW 7 90196967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGAAACAGACAGACAGACAGACAGAC -3'
(R):5'- ACTGGAGACTCAAAGGACTACTTACTGC -3'

Sequencing Primer
(F):5'- gccagagacactggacac -3'
(R):5'- ACTTACTGCCCACAAGGTTGG -3'
Posted On2013-11-08