Incidental Mutation 'R0855:Tbx20'
ID82692
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene NameT-box 20
SynonymsTbx12, 9430010M06Rik
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24718138-24774303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24725612 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 393 (M393T)
Ref Sequence ENSEMBL: ENSMUSP00000052591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946]
Predicted Effect probably benign
Transcript: ENSMUST00000052946
AA Change: M393T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: M393T

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
BB006:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
BB016:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0856:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R1981:Tbx20 UTSW 9 24770913 missense possibly damaging 0.85
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5436:Tbx20 UTSW 9 24769720 missense probably damaging 1.00
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6914:Tbx20 UTSW 9 24725483 missense probably benign 0.19
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 splice site probably null
R7731:Tbx20 UTSW 9 24770697 missense probably damaging 1.00
R7741:Tbx20 UTSW 9 24740285 splice site probably null
R7832:Tbx20 UTSW 9 24773812 missense probably damaging 1.00
R7929:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R7982:Tbx20 UTSW 9 24773924 unclassified probably benign
R8110:Tbx20 UTSW 9 24725525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGAGAGTCCTTGCTCCAAT -3'
(R):5'- GTCTCTCAGTTCCTGGGTATCGTCA -3'

Sequencing Primer
(F):5'- CATAGCCATTTGCACACTCTG -3'
(R):5'- AGTTCCTGGGTATCGTCATCTTC -3'
Posted On2013-11-08