Incidental Mutation 'R0855:Smtn'
ID82694
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Namesmoothelin
Synonyms
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3517523-3540612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3521880 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 853 (D853G)
Ref Sequence ENSEMBL: ENSMUSP00000105638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000094469] [ENSMUST00000110011] [ENSMUST00000170588]
Predicted Effect probably damaging
Transcript: ENSMUST00000020718
AA Change: D368G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439
AA Change: D368G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000020721
AA Change: D853G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: D853G

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075118
AA Change: D853G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: D853G

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094469
SMART Domains Protein: ENSMUSP00000092041
Gene: ENSMUSG00000075702

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sep15_SelM 40 114 3.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110011
AA Change: D853G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: D853G

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably damaging
Transcript: ENSMUST00000170588
AA Change: D853G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: D853G

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.9372 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3526326 critical splice donor site probably null
IGL02335:Smtn APN 11 3526215 missense probably damaging 1.00
IGL02473:Smtn APN 11 3532463 missense probably damaging 1.00
IGL02678:Smtn APN 11 3526353 missense possibly damaging 0.95
IGL02824:Smtn APN 11 3532658 missense probably damaging 1.00
IGL03067:Smtn APN 11 3530165 missense possibly damaging 0.53
IGL03142:Smtn APN 11 3532601 nonsense probably null
runtish UTSW 11 3531326 missense possibly damaging 0.89
R0279:Smtn UTSW 11 3530235 missense probably damaging 0.99
R0523:Smtn UTSW 11 3524664 missense possibly damaging 0.89
R1080:Smtn UTSW 11 3517693 missense probably damaging 1.00
R1218:Smtn UTSW 11 3530021 missense probably benign
R1571:Smtn UTSW 11 3530102 missense probably benign 0.00
R1899:Smtn UTSW 11 3531326 missense possibly damaging 0.89
R2033:Smtn UTSW 11 3517781 missense probably benign 0.43
R2126:Smtn UTSW 11 3530045 missense probably benign 0.02
R2358:Smtn UTSW 11 3532865 splice site probably null
R3690:Smtn UTSW 11 3527687 intron probably benign
R3712:Smtn UTSW 11 3532865 splice site probably null
R4108:Smtn UTSW 11 3526449 missense probably benign 0.10
R4709:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4710:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4830:Smtn UTSW 11 3520736 intron probably benign
R4944:Smtn UTSW 11 3522916 missense probably damaging 1.00
R4959:Smtn UTSW 11 3527825 start codon destroyed probably null
R5223:Smtn UTSW 11 3529530 missense probably benign 0.00
R5554:Smtn UTSW 11 3520811 nonsense probably null
R5610:Smtn UTSW 11 3529582 missense probably damaging 1.00
R5636:Smtn UTSW 11 3517829 critical splice acceptor site probably null
R5972:Smtn UTSW 11 3533486 missense probably damaging 1.00
R6108:Smtn UTSW 11 3529608 missense probably damaging 0.99
R6227:Smtn UTSW 11 3527624 intron probably benign
R7016:Smtn UTSW 11 3530368 critical splice donor site probably null
R7423:Smtn UTSW 11 3531200 critical splice donor site probably null
R7426:Smtn UTSW 11 3530249 missense probably benign 0.10
R7447:Smtn UTSW 11 3530196 missense probably benign
R7496:Smtn UTSW 11 3529988 missense probably damaging 0.99
R7716:Smtn UTSW 11 3524708 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCCTCCTTTTGGAATCTCCAGC -3'
(R):5'- TGAACAGACAAGGTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- GCCACCTGATGGGTTTTAGC -3'
(R):5'- CTAGGACTGCGATGCCAAAATG -3'
Posted On2013-11-08