Incidental Mutation 'R0855:Ppp2ca'
ID82695
Institutional Source Beutler Lab
Gene Symbol Ppp2ca
Ensembl Gene ENSMUSG00000020349
Gene Nameprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
SynonymsPP2A
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0855 (G1)
Quality Score223
Status Validated
Chromosome11
Chromosomal Location52098681-52127778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52121925 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 294 (R294H)
Ref Sequence ENSEMBL: ENSMUSP00000020608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020608]
Predicted Effect probably benign
Transcript: ENSMUST00000020608
AA Change: R294H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020608
Gene: ENSMUSG00000020349
AA Change: R294H

DomainStartEndE-ValueType
PP2Ac 23 293 3.46e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes an alpha isoform of the catalytic subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die before gastrulation and exhibit widespread degeneration. Mesoderm is not formed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Ppp2ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp2ca APN 11 52121949 missense probably benign 0.02
IGL01767:Ppp2ca APN 11 52118055 nonsense probably null
IGL01982:Ppp2ca APN 11 52099064 missense probably benign
IGL03260:Ppp2ca APN 11 52113148 missense probably damaging 0.96
R0539:Ppp2ca UTSW 11 52118162 critical splice donor site probably null
R0788:Ppp2ca UTSW 11 52113142 missense possibly damaging 0.92
R1539:Ppp2ca UTSW 11 52120973 missense probably damaging 0.99
R1591:Ppp2ca UTSW 11 52099089 missense possibly damaging 0.93
R1766:Ppp2ca UTSW 11 52121946 missense probably benign
R2267:Ppp2ca UTSW 11 52118086 missense probably damaging 1.00
R2268:Ppp2ca UTSW 11 52118086 missense probably damaging 1.00
R3933:Ppp2ca UTSW 11 52119262 missense probably damaging 1.00
R4199:Ppp2ca UTSW 11 52099101 missense probably benign
R4992:Ppp2ca UTSW 11 52113206 missense possibly damaging 0.52
R5261:Ppp2ca UTSW 11 52099110 missense probably benign
R5684:Ppp2ca UTSW 11 52113327 missense probably damaging 1.00
R5729:Ppp2ca UTSW 11 52118029 missense probably damaging 1.00
R5766:Ppp2ca UTSW 11 52113187 missense probably damaging 1.00
R7186:Ppp2ca UTSW 11 52119253 missense possibly damaging 0.95
R8073:Ppp2ca UTSW 11 52119297 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- acaaaGCAGAGAGAAGTGTGTGGG -3'
(R):5'- TGACCAACAATGTCGCGTCAGC -3'

Sequencing Primer
(F):5'- gattttcttgcctcagtttccc -3'
(R):5'- CATCTTTTGGTCCGTGTGAAAAC -3'
Posted On2013-11-08