Incidental Mutation 'R0855:Btn1a1'
ID82698
Institutional Source Beutler Lab
Gene Symbol Btn1a1
Ensembl Gene ENSMUSG00000000706
Gene Namebutyrophilin, subfamily 1, member A1
SynonymsBtn
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23456992-23465901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23464319 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 115 (V115F)
Ref Sequence ENSEMBL: ENSMUSP00000106064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]
Predicted Effect probably damaging
Transcript: ENSMUST00000041674
AA Change: V115F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706
AA Change: V115F

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
IG_like 150 237 9.03e1 SMART
transmembrane domain 246 268 N/A INTRINSIC
PRY 303 355 2.64e-27 SMART
SPRY 356 477 1.46e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110434
AA Change: V115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706
AA Change: V115F

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225831
Meta Mutation Damage Score 0.6458 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Btn1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Btn1a1 APN 13 23461737 missense possibly damaging 0.56
IGL01608:Btn1a1 APN 13 23461608 missense probably benign 0.00
IGL02538:Btn1a1 APN 13 23459215 missense possibly damaging 0.50
IGL02795:Btn1a1 APN 13 23460616 critical splice acceptor site probably null
IGL02933:Btn1a1 APN 13 23460527 missense possibly damaging 0.63
R0063:Btn1a1 UTSW 13 23465097 splice site probably null
R1754:Btn1a1 UTSW 13 23460468 missense probably benign 0.01
R2122:Btn1a1 UTSW 13 23461521 missense probably damaging 1.00
R3110:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3112:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3941:Btn1a1 UTSW 13 23459264 missense probably benign 0.01
R4169:Btn1a1 UTSW 13 23465155 missense probably benign
R4924:Btn1a1 UTSW 13 23464226 splice site probably benign
R4927:Btn1a1 UTSW 13 23460624 splice site probably null
R5255:Btn1a1 UTSW 13 23464154 intron probably benign
R5554:Btn1a1 UTSW 13 23459125 missense possibly damaging 0.55
R5726:Btn1a1 UTSW 13 23459352 missense probably damaging 1.00
R6228:Btn1a1 UTSW 13 23464351 missense probably damaging 0.98
R6664:Btn1a1 UTSW 13 23459320 missense probably benign 0.00
R7117:Btn1a1 UTSW 13 23459245 missense possibly damaging 0.91
R7150:Btn1a1 UTSW 13 23459351 missense probably damaging 1.00
R7151:Btn1a1 UTSW 13 23459313 missense probably damaging 1.00
R7396:Btn1a1 UTSW 13 23461498 missense probably benign 0.01
R7504:Btn1a1 UTSW 13 23461716 missense probably benign 0.10
R7874:Btn1a1 UTSW 13 23459215 missense possibly damaging 0.50
R7878:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
R8271:Btn1a1 UTSW 13 23461749 missense probably benign
R8354:Btn1a1 UTSW 13 23464250 missense probably benign 0.00
R8454:Btn1a1 UTSW 13 23464250 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCCCCAAAGTGAGAGTCTCCG -3'
(R):5'- TACAGCAGCTCCCTTCGATGTGAC -3'

Sequencing Primer
(F):5'- AGCCACTTTGAGGTATACGG -3'
(R):5'- GCTTTTCCCCAAACGCGAG -3'
Posted On2013-11-08