Incidental Mutation 'R0855:Mak'
ID82699
Institutional Source Beutler Lab
Gene Symbol Mak
Ensembl Gene ENSMUSG00000021363
Gene Namemale germ cell-associated kinase
SynonymsA930010O05Rik
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41025008-41079706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41070164 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 25 (E25G)
Ref Sequence ENSEMBL: ENSMUSP00000152946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021792] [ENSMUST00000070193] [ENSMUST00000165087] [ENSMUST00000224423] [ENSMUST00000224740] [ENSMUST00000225084]
Predicted Effect probably damaging
Transcript: ENSMUST00000021792
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021792
Gene: ENSMUSG00000021363
AA Change: E25G

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070193
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064750
Gene: ENSMUSG00000021363
AA Change: E25G

DomainStartEndE-ValueType
S_TKc 4 253 3.81e-70 SMART
low complexity region 325 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165087
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129615
Gene: ENSMUSG00000021363
AA Change: E25G

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224423
AA Change: E25G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000224740
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225084
AA Change: E25G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225789
Meta Mutation Damage Score 0.2964 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit slight reductions in litter size and sperm motility in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Mak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Mak APN 13 41055689 splice site probably benign
IGL00543:Mak APN 13 41055713 missense probably damaging 1.00
IGL00772:Mak APN 13 41055820 splice site probably benign
IGL01113:Mak APN 13 41042143 missense probably damaging 1.00
IGL01363:Mak APN 13 41053377 splice site probably benign
IGL01673:Mak APN 13 41048223 splice site probably null
IGL01872:Mak APN 13 41056655 missense probably damaging 1.00
IGL02051:Mak APN 13 41042082 missense probably benign 0.00
R0126:Mak UTSW 13 41032596 missense probably damaging 1.00
R0377:Mak UTSW 13 41049348 missense probably damaging 1.00
R0511:Mak UTSW 13 41046267 missense probably benign
R0557:Mak UTSW 13 41039659 missense probably benign 0.11
R0616:Mak UTSW 13 41042185 missense probably benign 0.05
R0786:Mak UTSW 13 41046069 missense probably benign 0.00
R1430:Mak UTSW 13 41070284 start gained probably benign
R1603:Mak UTSW 13 41042106 missense possibly damaging 0.69
R1759:Mak UTSW 13 41056634 missense probably damaging 0.98
R2042:Mak UTSW 13 41049436 missense possibly damaging 0.60
R2148:Mak UTSW 13 41042037 missense probably benign 0.01
R2155:Mak UTSW 13 41032544 missense probably benign 0.00
R4124:Mak UTSW 13 41056630 missense probably benign 0.00
R5040:Mak UTSW 13 41030098 missense possibly damaging 0.61
R5141:Mak UTSW 13 41032563 missense possibly damaging 0.94
R6167:Mak UTSW 13 41053352 missense probably benign 0.07
R6937:Mak UTSW 13 41048102 missense probably damaging 1.00
R6964:Mak UTSW 13 41032591 missense probably benign 0.00
R7201:Mak UTSW 13 41051440 missense possibly damaging 0.94
R7474:Mak UTSW 13 41051480 missense probably damaging 1.00
R7644:Mak UTSW 13 41030110 missense probably benign 0.01
R8057:Mak UTSW 13 41049337 missense probably damaging 1.00
R8247:Mak UTSW 13 41039670 missense possibly damaging 0.76
R8344:Mak UTSW 13 41046203 missense probably benign 0.31
X0024:Mak UTSW 13 41051369 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCTCAAATGTATCGAGCACTCAGACT -3'
(R):5'- CCTGTCTCCAGTGTAGCAACAACAA -3'

Sequencing Primer
(F):5'- CGAGCACTCAGACTTACTTGG -3'
(R):5'- TGTAGCAACAACAACAAAAAAAGG -3'
Posted On2013-11-08