Incidental Mutation 'R0855:Anks3'
ID82702
Institutional Source Beutler Lab
Gene Symbol Anks3
Ensembl Gene ENSMUSG00000022515
Gene Nameankyrin repeat and sterile alpha motif domain containing 3
Synonyms2700067D09Rik
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4941436-4964205 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 4955947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023157] [ENSMUST00000229017] [ENSMUST00000229765]
Predicted Effect probably benign
Transcript: ENSMUST00000023157
SMART Domains Protein: ENSMUSP00000023157
Gene: ENSMUSG00000022515

DomainStartEndE-ValueType
ANK 34 64 1.25e2 SMART
ANK 68 97 9.93e-5 SMART
ANK 101 130 9.13e-4 SMART
ANK 134 163 2.45e-4 SMART
ANK 168 197 9.27e-5 SMART
ANK 201 230 5.87e2 SMART
SAM 421 487 9.8e-12 SMART
coiled coil region 500 533 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229077
Predicted Effect probably benign
Transcript: ENSMUST00000229765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230771
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Anks3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Anks3 APN 16 4953929 missense possibly damaging 0.93
IGL01705:Anks3 APN 16 4947723 missense probably benign 0.00
IGL01953:Anks3 APN 16 4960544 missense probably damaging 1.00
IGL02378:Anks3 APN 16 4950762 missense possibly damaging 0.91
IGL03126:Anks3 APN 16 4958027 missense probably damaging 1.00
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0661:Anks3 UTSW 16 4948334 missense probably damaging 1.00
R0932:Anks3 UTSW 16 4953827 missense probably damaging 1.00
R1604:Anks3 UTSW 16 4948253 missense probably damaging 0.99
R1773:Anks3 UTSW 16 4947294 missense probably benign
R1846:Anks3 UTSW 16 4953884 missense probably benign 0.07
R1928:Anks3 UTSW 16 4946054 critical splice donor site probably null
R2323:Anks3 UTSW 16 4950770 critical splice acceptor site probably null
R3916:Anks3 UTSW 16 4947279 missense probably damaging 0.97
R5597:Anks3 UTSW 16 4953929 missense possibly damaging 0.93
R5993:Anks3 UTSW 16 4958137 missense probably damaging 1.00
R7345:Anks3 UTSW 16 4955910 missense possibly damaging 0.88
R7373:Anks3 UTSW 16 4955871 missense probably benign 0.00
Z1176:Anks3 UTSW 16 4950714 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACTCGGCACTGTACGAGTATCAGAG -3'
(R):5'- CCATGACTCCAGCAAGGTGGAAAG -3'

Sequencing Primer
(F):5'- cagttcccaaaaaacagactcc -3'
(R):5'- GAAAGGCAAAGATCAGCACC -3'
Posted On2013-11-08