Incidental Mutation 'R0855:Kcnk7'
ID82706
Institutional Source Beutler Lab
Gene Symbol Kcnk7
Ensembl Gene ENSMUSG00000024936
Gene Namepotassium channel, subfamily K, member 7
SynonymsKnot, 2310014G03Rik, Mlk3, Kcnk8
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0855 (G1)
Quality Score158
Status Validated
Chromosome19
Chromosomal Location5704367-5707101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5706075 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 110 (H110Y)
Ref Sequence ENSEMBL: ENSMUSP00000051278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000049295] [ENSMUST00000052448] [ENSMUST00000075606]
Predicted Effect probably benign
Transcript: ENSMUST00000004156
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049295
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052448
AA Change: H110Y

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000051278
Gene: ENSMUSG00000024936
AA Change: H110Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Ion_trans_2 67 145 3.2e-14 PFAM
Pfam:Ion_trans_2 175 261 8.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Meta Mutation Damage Score 0.1916 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and behaviorally normal with no significant alterations in volatile anesthetic sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Ak3 T C 19: 29,022,945 K189E probably benign Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Kcnk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Kcnk7 APN 19 5706202 missense probably damaging 0.99
IGL02348:Kcnk7 APN 19 5706473 unclassified probably benign
IGL03159:Kcnk7 APN 19 5706088 missense probably damaging 1.00
R0025:Kcnk7 UTSW 19 5707014 makesense probably null
R0739:Kcnk7 UTSW 19 5704802 splice site probably null
R1506:Kcnk7 UTSW 19 5706112 missense probably damaging 1.00
R1676:Kcnk7 UTSW 19 5706978 missense probably benign 0.02
R1716:Kcnk7 UTSW 19 5706831 missense probably damaging 1.00
R4619:Kcnk7 UTSW 19 5706435 missense probably benign 0.00
R4715:Kcnk7 UTSW 19 5706253 missense probably damaging 1.00
R5119:Kcnk7 UTSW 19 5706324 missense probably benign 0.00
R7018:Kcnk7 UTSW 19 5706132 missense probably damaging 1.00
R7136:Kcnk7 UTSW 19 5706076 missense probably benign 0.02
R7224:Kcnk7 UTSW 19 5706777 missense probably benign
R8458:Kcnk7 UTSW 19 5704379 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTAAGAAGCCAGTCCACCATCCAG -3'
(R):5'- ATCGTGCTGAGTGAGCCGAAAC -3'

Sequencing Primer
(F):5'- GTCCACCATCCAGTGAAAAGAG -3'
(R):5'- ACAGAAGTAGATGGCTTCTAGC -3'
Posted On2013-11-08