Incidental Mutation 'R0855:Ak3'
ID82707
Institutional Source Beutler Lab
Gene Symbol Ak3
Ensembl Gene ENSMUSG00000024782
Gene Nameadenylate kinase 3
SynonymsAK-3
MMRRC Submission 039034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R0855 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29020833-29047961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29022945 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 189 (K189E)
Ref Sequence ENSEMBL: ENSMUSP00000025696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025696] [ENSMUST00000050148] [ENSMUST00000224511]
Predicted Effect probably benign
Transcript: ENSMUST00000025696
AA Change: K189E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025696
Gene: ENSMUSG00000024782
AA Change: K189E

DomainStartEndE-ValueType
Pfam:AAA_17 9 172 2.4e-7 PFAM
Pfam:ADK 12 192 2.6e-52 PFAM
Pfam:ADK_lid 128 163 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050148
SMART Domains Protein: ENSMUSP00000060421
Gene: ENSMUSG00000024780

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 21 40 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
CDC37_M 132 288 7.15e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125587
SMART Domains Protein: ENSMUSP00000121867
Gene: ENSMUSG00000024782

DomainStartEndE-ValueType
Pfam:ADK_lid 5 40 2.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224511
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700046A07Rik A G 18: 62,753,343 noncoding transcript Het
Anks3 A T 16: 4,955,947 probably benign Het
Ash1l C A 3: 89,054,454 H2378N possibly damaging Het
Baz1a A G 12: 54,900,563 probably benign Het
Bicra A G 7: 15,972,004 F1504S probably damaging Het
Blzf1 T C 1: 164,292,381 T353A possibly damaging Het
Btn1a1 C A 13: 23,464,319 V115F probably damaging Het
Cd38 T A 5: 43,903,585 probably null Het
Cep250 T C 2: 155,964,111 C109R probably damaging Het
Cnksr1 C T 4: 134,233,066 probably benign Het
Dmxl2 T A 9: 54,366,440 N3048I probably benign Het
Impdh1 T A 6: 29,206,972 H116L probably damaging Het
Kank4 C A 4: 98,771,444 W799L probably damaging Het
Kcnk7 C T 19: 5,706,075 H110Y probably benign Het
Mak T C 13: 41,070,164 E25G probably damaging Het
Mrpl54 G A 10: 81,266,925 probably benign Het
Myh10 A C 11: 68,811,801 D1767A possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ndufaf6 A T 4: 11,051,169 H310Q probably damaging Het
Osbpl6 G T 2: 76,585,133 G467V probably damaging Het
Osbpl6 A G 2: 76,591,839 E673G probably damaging Het
Picalm T A 7: 90,191,148 D458E possibly damaging Het
Ppp2ca G A 11: 52,121,925 R294H probably benign Het
Prdm14 T A 1: 13,125,537 N100I probably benign Het
Rbbp6 A G 7: 122,992,248 T510A probably benign Het
Sars C A 3: 108,426,932 E503D probably benign Het
Smtn T C 11: 3,521,880 D853G probably damaging Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Thada T C 17: 84,436,655 T742A probably damaging Het
Tmem63a T C 1: 180,961,060 S321P possibly damaging Het
Trim24 T A 6: 37,915,202 C223* probably null Het
Usp48 T C 4: 137,608,154 F213L probably damaging Het
Vmn2r109 A T 17: 20,541,408 Y562* probably null Het
Other mutations in Ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03162:Ak3 APN 19 29022836 missense possibly damaging 0.61
PIT4243001:Ak3 UTSW 19 29037871 critical splice donor site probably null
PIT4469001:Ak3 UTSW 19 29047757 missense probably damaging 0.97
R0277:Ak3 UTSW 19 29047792 missense possibly damaging 0.80
R1747:Ak3 UTSW 19 29022861 missense possibly damaging 0.87
R2141:Ak3 UTSW 19 29022847 missense probably benign 0.00
R3979:Ak3 UTSW 19 29047718 missense probably damaging 1.00
R4839:Ak3 UTSW 19 29047732 missense probably damaging 0.99
R6207:Ak3 UTSW 19 29022940 missense probably damaging 0.99
R6702:Ak3 UTSW 19 29026227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCAGTTGCTCTCCGAGTTAG -3'
(R):5'- GCATTGTCCAGTCAAGTTTCTTGCC -3'

Sequencing Primer
(F):5'- CAGATCAGGCTAAGTATCTGACTC -3'
(R):5'- TTGCCCCTGGATCAGAGAC -3'
Posted On2013-11-08