Incidental Mutation 'R0856:Klhl32'
ID82712
Institutional Source Beutler Lab
Gene Symbol Klhl32
Ensembl Gene ENSMUSG00000040387
Gene Namekelch-like 32
SynonymsLOC384000, D4Ertd389e, 6430524H05Rik
MMRRC Submission 039035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0856 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location24612554-24851124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24682092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000103853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652] [ENSMUST00000150920]
Predicted Effect probably damaging
Transcript: ENSMUST00000084781
AA Change: D164G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387
AA Change: D164G

DomainStartEndE-ValueType
BTB 42 138 1.28e-22 SMART
BACK 111 212 3.17e-22 SMART
Kelch 257 313 4.07e-1 SMART
Kelch 314 365 3.57e-1 SMART
Kelch 366 413 3.77e-4 SMART
Kelch 414 461 7.04e-4 SMART
Kelch 462 514 6.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108213
Predicted Effect probably damaging
Transcript: ENSMUST00000108214
AA Change: D197G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387
AA Change: D197G

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 225 3.31e-2 SMART
Blast:Kelch 233 285 1e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108218
AA Change: D197G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387
AA Change: D197G

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 245 3.17e-22 SMART
Kelch 290 346 4.07e-1 SMART
Kelch 347 398 3.57e-1 SMART
Kelch 399 446 3.77e-4 SMART
Kelch 447 494 7.04e-4 SMART
Kelch 495 547 6.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140652
SMART Domains Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.14e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150920
SMART Domains Protein: ENSMUSP00000135917
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
Blast:BTB 1 49 4e-19 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,948,027 S179G probably benign Het
Abcb11 A T 2: 69,323,918 S101R probably benign Het
Arhgap32 C A 9: 32,260,220 P1432Q probably damaging Het
Atp7b A G 8: 21,997,631 V1134A probably damaging Het
Crtc3 A T 7: 80,595,624 Y418N probably damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Defb39 T A 8: 19,052,966 T38S possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Kcnip4 A G 5: 48,419,210 probably null Het
Kif20a T C 18: 34,631,218 S666P probably benign Het
Men1 A G 19: 6,335,858 Y133C probably damaging Het
Mtnr1a A G 8: 45,087,833 E277G possibly damaging Het
Numa1 C A 7: 101,998,948 Q629K probably damaging Het
Olfr437 T C 6: 43,167,411 S118P probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Upf2 A G 2: 5,957,652 D55G unknown Het
Vit G T 17: 78,619,657 V344L possibly damaging Het
Vps26a A C 10: 62,468,410 V176G possibly damaging Het
Other mutations in Klhl32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Klhl32 APN 4 24682245 missense probably damaging 1.00
IGL02293:Klhl32 APN 4 24626935 missense probably damaging 1.00
IGL02374:Klhl32 APN 4 24743856 critical splice donor site probably null
IGL02824:Klhl32 APN 4 24682237 nonsense probably null
IGL03211:Klhl32 APN 4 24792616 critical splice donor site probably null
IGL03374:Klhl32 APN 4 24649533 intron probably benign
R0071:Klhl32 UTSW 4 24743907 missense probably damaging 0.98
R0478:Klhl32 UTSW 4 24792777 missense probably damaging 1.00
R0908:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R1882:Klhl32 UTSW 4 24743916 nonsense probably null
R1927:Klhl32 UTSW 4 24617474 missense probably benign 0.00
R2137:Klhl32 UTSW 4 24629275 nonsense probably null
R3176:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R3276:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R4059:Klhl32 UTSW 4 24792781 missense probably damaging 1.00
R4246:Klhl32 UTSW 4 24800822 missense possibly damaging 0.50
R4597:Klhl32 UTSW 4 24629339 missense probably benign 0.21
R4801:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4802:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4929:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R5654:Klhl32 UTSW 4 24800805 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6362:Klhl32 UTSW 4 24629195 missense probably null 1.00
R6490:Klhl32 UTSW 4 24711578 intron probably benign
R6948:Klhl32 UTSW 4 24629250 missense probably benign 0.00
R6981:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGCCTTCAGTGACTTGCTTAAC -3'
(R):5'- GGTCCTAATACTAATGGCCCCATCCC -3'

Sequencing Primer
(F):5'- CAGTGACTTGCTTAACTAGGGAG -3'
(R):5'- CCCGTGCCTGTTATAAAAACAGTG -3'
Posted On2013-11-08