Incidental Mutation 'R0856:Olfr437'
ID82715
Institutional Source Beutler Lab
Gene Symbol Olfr437
Ensembl Gene ENSMUSG00000071481
Gene Nameolfactory receptor 437
SynonymsGA_x6K02T2P3E9-4391088-4390156, MOR261-11
MMRRC Submission 039035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0856 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location43163282-43169861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43167411 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000145490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060243] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably damaging
Transcript: ENSMUST00000060243
AA Change: S118P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058147
Gene: ENSMUSG00000071481
AA Change: S118P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205175
AA Change: S118P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481
AA Change: S118P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,948,027 S179G probably benign Het
Abcb11 A T 2: 69,323,918 S101R probably benign Het
Arhgap32 C A 9: 32,260,220 P1432Q probably damaging Het
Atp7b A G 8: 21,997,631 V1134A probably damaging Het
Crtc3 A T 7: 80,595,624 Y418N probably damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Defb39 T A 8: 19,052,966 T38S possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Kcnip4 A G 5: 48,419,210 probably null Het
Kif20a T C 18: 34,631,218 S666P probably benign Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Men1 A G 19: 6,335,858 Y133C probably damaging Het
Mtnr1a A G 8: 45,087,833 E277G possibly damaging Het
Numa1 C A 7: 101,998,948 Q629K probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Upf2 A G 2: 5,957,652 D55G unknown Het
Vit G T 17: 78,619,657 V344L possibly damaging Het
Vps26a A C 10: 62,468,410 V176G possibly damaging Het
Other mutations in Olfr437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr437 APN 6 43167390 missense probably damaging 1.00
IGL01618:Olfr437 APN 6 43167703 missense probably damaging 0.97
IGL02426:Olfr437 APN 6 43167088 missense probably benign 0.02
R0548:Olfr437 UTSW 6 43167187 missense probably benign 0.43
R1590:Olfr437 UTSW 6 43167912 missense probably damaging 1.00
R1902:Olfr437 UTSW 6 43167723 unclassified probably null
R3894:Olfr437 UTSW 6 43167258 missense probably benign 0.23
R5083:Olfr437 UTSW 6 43167339 missense probably benign 0.33
R5278:Olfr437 UTSW 6 43167721 missense probably damaging 1.00
R6246:Olfr437 UTSW 6 43167502 unclassified probably null
R6781:Olfr437 UTSW 6 43167388 missense probably damaging 1.00
R6807:Olfr437 UTSW 6 43167238 missense probably damaging 1.00
R7253:Olfr437 UTSW 6 43167810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTAGTCATCTGCCTGGACCCC -3'
(R):5'- AGCTTGAGAACAGCCAGGATTTCAC -3'

Sequencing Primer
(F):5'- TGGACCCCAAGCTGCAC -3'
(R):5'- CACAGAAGAGGTGGTTTATTTCC -3'
Posted On2013-11-08