Incidental Mutation 'R0856:Crtc3'
ID82718
Institutional Source Beutler Lab
Gene Symbol Crtc3
Ensembl Gene ENSMUSG00000030527
Gene NameCREB regulated transcription coactivator 3
Synonyms
MMRRC Submission 039035-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R0856 (G1)
Quality Score162
Status Not validated
Chromosome7
Chromosomal Location80586627-80688877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80595624 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 418 (Y418N)
Ref Sequence ENSEMBL: ENSMUSP00000113540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122255]
Predicted Effect probably damaging
Transcript: ENSMUST00000122255
AA Change: Y418N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113540
Gene: ENSMUSG00000030527
AA Change: Y418N

DomainStartEndE-ValueType
Pfam:TORC_N 11 82 1.2e-20 PFAM
Pfam:TORC_M 159 321 1.9e-64 PFAM
low complexity region 366 380 N/A INTRINSIC
low complexity region 438 480 N/A INTRINSIC
Pfam:TORC_C 545 619 2.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127182
Predicted Effect probably benign
Transcript: ENSMUST00000127326
Predicted Effect probably benign
Transcript: ENSMUST00000149176
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null mutation display resistance to diet-induced obesity, increased energy expenditure, decreased white adipose tissue mass, increased brown adipose cell numbers, and increased core temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,948,027 S179G probably benign Het
Abcb11 A T 2: 69,323,918 S101R probably benign Het
Arhgap32 C A 9: 32,260,220 P1432Q probably damaging Het
Atp7b A G 8: 21,997,631 V1134A probably damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Defb39 T A 8: 19,052,966 T38S possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Kcnip4 A G 5: 48,419,210 probably null Het
Kif20a T C 18: 34,631,218 S666P probably benign Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Men1 A G 19: 6,335,858 Y133C probably damaging Het
Mtnr1a A G 8: 45,087,833 E277G possibly damaging Het
Numa1 C A 7: 101,998,948 Q629K probably damaging Het
Olfr437 T C 6: 43,167,411 S118P probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Upf2 A G 2: 5,957,652 D55G unknown Het
Vit G T 17: 78,619,657 V344L possibly damaging Het
Vps26a A C 10: 62,468,410 V176G possibly damaging Het
Other mutations in Crtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Crtc3 APN 7 80598739 intron probably benign
IGL01325:Crtc3 APN 7 80677368 missense probably damaging 0.96
IGL01802:Crtc3 APN 7 80604368 nonsense probably null
IGL02166:Crtc3 APN 7 80677399 missense probably damaging 1.00
IGL02601:Crtc3 APN 7 80592567 missense probably damaging 1.00
IGL02719:Crtc3 APN 7 80618658 critical splice acceptor site probably null
IGL02936:Crtc3 APN 7 80589763 missense probably damaging 1.00
IGL03075:Crtc3 APN 7 80604403 intron probably benign
R1655:Crtc3 UTSW 7 80598776 missense possibly damaging 0.67
R1962:Crtc3 UTSW 7 80589931 missense probably damaging 1.00
R4484:Crtc3 UTSW 7 80589948 missense probably damaging 1.00
R4533:Crtc3 UTSW 7 80589795 missense probably damaging 0.97
R4818:Crtc3 UTSW 7 80677422 missense possibly damaging 0.65
R5292:Crtc3 UTSW 7 80618610 missense possibly damaging 0.94
R5908:Crtc3 UTSW 7 80595794 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCAACTTTAGCCTGAACTGCCTTTC -3'
(R):5'- ACTCAGTAAGATGGCACTCTCCTCG -3'

Sequencing Primer
(F):5'- CCCCAGGCCCAAGTTTATG -3'
(R):5'- TCAAGTGCCACCCGCAG -3'
Posted On2013-11-08