Incidental Mutation 'R0856:Tbx20'
ID82723
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene NameT-box 20
SynonymsTbx12, 9430010M06Rik
MMRRC Submission 039035-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0856 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location24718138-24774303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24725612 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 393 (M393T)
Ref Sequence ENSEMBL: ENSMUSP00000052591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946]
Predicted Effect probably benign
Transcript: ENSMUST00000052946
AA Change: M393T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: M393T

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,948,027 S179G probably benign Het
Abcb11 A T 2: 69,323,918 S101R probably benign Het
Arhgap32 C A 9: 32,260,220 P1432Q probably damaging Het
Atp7b A G 8: 21,997,631 V1134A probably damaging Het
Crtc3 A T 7: 80,595,624 Y418N probably damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Defb39 T A 8: 19,052,966 T38S possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Kcnip4 A G 5: 48,419,210 probably null Het
Kif20a T C 18: 34,631,218 S666P probably benign Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Men1 A G 19: 6,335,858 Y133C probably damaging Het
Mtnr1a A G 8: 45,087,833 E277G possibly damaging Het
Numa1 C A 7: 101,998,948 Q629K probably damaging Het
Olfr437 T C 6: 43,167,411 S118P probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Upf2 A G 2: 5,957,652 D55G unknown Het
Vit G T 17: 78,619,657 V344L possibly damaging Het
Vps26a A C 10: 62,468,410 V176G possibly damaging Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
BB006:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
BB016:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0855:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R1981:Tbx20 UTSW 9 24770913 missense possibly damaging 0.85
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5436:Tbx20 UTSW 9 24769720 missense probably damaging 1.00
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6914:Tbx20 UTSW 9 24725483 missense probably benign 0.19
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 splice site probably null
R7731:Tbx20 UTSW 9 24770697 missense probably damaging 1.00
R7741:Tbx20 UTSW 9 24740285 splice site probably null
R7832:Tbx20 UTSW 9 24773812 missense probably damaging 1.00
R7929:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R7982:Tbx20 UTSW 9 24773924 unclassified probably benign
R8110:Tbx20 UTSW 9 24725525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCGACTCTCAGTGGAATCATACA -3'
(R):5'- CCTGACTATTCTTGGGTGTGGAGCA -3'

Sequencing Primer
(F):5'- CTCTCAGTGGAATCATACAAATGGC -3'
(R):5'- ggaggcaaaggaaggcaag -3'
Posted On2013-11-08