Mutagenetix > Incidental Mutation

Incidental Mutation 'R0856:Arhgap32'

82724

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik

MMRRC Submission

039035-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32027432-32179742 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32171516 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1432 (P1432Q)

Ref Sequence

ENSEMBL: ENSMUSP00000138145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]

AlphaFold

Q811P8

Predicted Effect

probably damaging
Transcript: ENSMUST00000168954
AA Change: P1432Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: P1432Q

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174641
AA Change: P1781Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: P1781Q

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182802
AA Change: P1432Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: P1432Q

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,154,262 (GRCm39)	S101R	probably benign	Het
Atp7b	A	G	8: 22,487,647 (GRCm39)	V1134A	probably damaging	Het
Crtc3	A	T	7: 80,245,372 (GRCm39)	Y418N	probably damaging	Het
Cts8	A	T	13: 61,398,730 (GRCm39)	Y259N	probably damaging	Het
Defb39	T	A	8: 19,102,982 (GRCm39)	T38S	possibly damaging	Het
Depdc7	A	G	2: 104,558,437 (GRCm39)	S195P	probably benign	Het
Gykl1	T	A	18: 52,828,441 (GRCm39)	*550K	probably null	Het
Kcnip4	A	G	5: 48,576,552 (GRCm39)		probably null	Het
Kif20a	T	C	18: 34,764,271 (GRCm39)	S666P	probably benign	Het
Klhl32	T	C	4: 24,682,092 (GRCm39)	D197G	probably damaging	Het
Men1	A	G	19: 6,385,888 (GRCm39)	Y133C	probably damaging	Het
Mtnr1a	A	G	8: 45,540,870 (GRCm39)	E277G	possibly damaging	Het
Numa1	C	A	7: 101,648,155 (GRCm39)	Q629K	probably damaging	Het
Or2a52	T	C	6: 43,144,345 (GRCm39)	S118P	probably damaging	Het
P3h3	G	T	6: 124,831,896 (GRCm39)	D296E	probably benign	Het
Prl7c1	A	G	13: 27,957,717 (GRCm39)	I241T	possibly damaging	Het
Prr35	T	C	17: 26,167,001 (GRCm39)	S179G	probably benign	Het
Rp1	T	C	1: 4,414,878 (GRCm39)	E2078G	probably benign	Het
Septin8	A	G	11: 53,428,697 (GRCm39)	H414R	probably benign	Het
Tbx20	A	G	9: 24,636,908 (GRCm39)	M393T	probably benign	Het
Upf2	A	G	2: 5,962,463 (GRCm39)	D55G	unknown	Het
Vit	G	T	17: 78,927,086 (GRCm39)	V344L	possibly damaging	Het
Vps26a	A	C	10: 62,304,189 (GRCm39)	V176G	possibly damaging	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32,168,657 (GRCm39)	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32,168,260 (GRCm39)	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32,171,801 (GRCm39)	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32,158,486 (GRCm39)	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32,170,627 (GRCm39)	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32,166,944 (GRCm39)	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32,158,490 (GRCm39)	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32,157,302 (GRCm39)	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32,172,431 (GRCm39)	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32,170,430 (GRCm39)	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32,170,816 (GRCm39)	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32,172,152 (GRCm39)	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32,063,294 (GRCm39)	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32,171,056 (GRCm39)	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32,157,773 (GRCm39)	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32,156,551 (GRCm39)	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32,170,199 (GRCm39)	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32,101,364 (GRCm39)	splice site	probably benign
R0990:Arhgap32	UTSW	9	32,166,677 (GRCm39)	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32,166,608 (GRCm39)	missense	probably benign
R1455:Arhgap32	UTSW	9	32,171,381 (GRCm39)	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32,027,498 (GRCm39)	missense	probably benign
R1523:Arhgap32	UTSW	9	32,168,048 (GRCm39)	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32,171,096 (GRCm39)	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32,170,727 (GRCm39)	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32,171,207 (GRCm39)	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32,150,694 (GRCm39)	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32,063,315 (GRCm39)	splice site	probably null
R3793:Arhgap32	UTSW	9	32,166,669 (GRCm39)	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32,101,320 (GRCm39)	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32,158,362 (GRCm39)	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32,158,510 (GRCm39)	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32,168,770 (GRCm39)	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32,171,185 (GRCm39)	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32,093,135 (GRCm39)	splice site	probably null
R4587:Arhgap32	UTSW	9	32,172,241 (GRCm39)	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32,170,775 (GRCm39)	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32,150,644 (GRCm39)	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32,081,441 (GRCm39)	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4784:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4906:Arhgap32	UTSW	9	32,156,552 (GRCm39)	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32,168,095 (GRCm39)	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32,170,967 (GRCm39)	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32,063,306 (GRCm39)	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32,159,678 (GRCm39)	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32,158,502 (GRCm39)	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32,093,256 (GRCm39)	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32,167,084 (GRCm39)	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32,168,275 (GRCm39)	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32,171,407 (GRCm39)	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32,159,784 (GRCm39)	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32,063,983 (GRCm39)	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32,157,272 (GRCm39)	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32,063,232 (GRCm39)	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32,097,679 (GRCm39)	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32,119,481 (GRCm39)	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32,063,993 (GRCm39)	missense
R7289:Arhgap32	UTSW	9	32,168,234 (GRCm39)	missense	probably benign	0.02
R7289:Arhgap32	UTSW	9	32,168,233 (GRCm39)	missense	possibly damaging	0.92
R7391:Arhgap32	UTSW	9	32,093,235 (GRCm39)	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32,157,220 (GRCm39)	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32,162,018 (GRCm39)	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32,168,263 (GRCm39)	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32,168,441 (GRCm39)	missense	probably benign
R7884:Arhgap32	UTSW	9	32,171,810 (GRCm39)	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32,168,324 (GRCm39)	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32,093,150 (GRCm39)	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32,158,426 (GRCm39)	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32,093,196 (GRCm39)	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32,168,198 (GRCm39)	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32,172,205 (GRCm39)	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32,167,233 (GRCm39)	nonsense	probably null
R8696:Arhgap32	UTSW	9	32,159,799 (GRCm39)	missense	possibly damaging	0.90
R8832:Arhgap32	UTSW	9	32,172,115 (GRCm39)	missense	possibly damaging	0.94
R9112:Arhgap32	UTSW	9	32,157,309 (GRCm39)	missense	probably damaging	0.99
R9170:Arhgap32	UTSW	9	32,162,039 (GRCm39)	missense	possibly damaging	0.47
R9279:Arhgap32	UTSW	9	32,168,655 (GRCm39)	missense	probably benign	0.01
R9431:Arhgap32	UTSW	9	32,170,463 (GRCm39)	missense	probably damaging	1.00
R9522:Arhgap32	UTSW	9	32,027,450 (GRCm39)	missense	probably benign
R9526:Arhgap32	UTSW	9	32,172,026 (GRCm39)	missense	probably benign	0.28
R9661:Arhgap32	UTSW	9	32,168,531 (GRCm39)	missense	probably benign	0.01
X0027:Arhgap32	UTSW	9	32,161,937 (GRCm39)	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32,172,365 (GRCm39)	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32,171,976 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACTATGCTGGTTTGCCTCCACG -3'
(R):5'- TCAAATTCGGACTCTGGGTGCTTC -3'

Sequencing Primer
(F):5'- GGCCAATGCAACTGGCTATTTC -3'
(R):5'- GTGCTTCCTGTAGAAACGC -3'

Posted On

2013-11-08