Incidental Mutation 'R0856:Gykl1'
ID82734
Institutional Source Beutler Lab
Gene Symbol Gykl1
Ensembl Gene ENSMUSG00000053624
Gene Nameglycerol kinase-like 1
SynonymsGk-rs1
MMRRC Submission 039035-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R0856 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location52693679-52695668 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 52695369 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 550 (*550K)
Ref Sequence ENSEMBL: ENSMUSP00000067598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066193]
Predicted Effect probably null
Transcript: ENSMUST00000066193
AA Change: *550K
SMART Domains Protein: ENSMUSP00000067598
Gene: ENSMUSG00000053624
AA Change: *550K

DomainStartEndE-ValueType
Pfam:FGGY_N 12 266 6.8e-90 PFAM
Pfam:FGGY_C 275 467 4.2e-66 PFAM
transmembrane domain 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,948,027 S179G probably benign Het
Abcb11 A T 2: 69,323,918 S101R probably benign Het
Arhgap32 C A 9: 32,260,220 P1432Q probably damaging Het
Atp7b A G 8: 21,997,631 V1134A probably damaging Het
Crtc3 A T 7: 80,595,624 Y418N probably damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Defb39 T A 8: 19,052,966 T38S possibly damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Kcnip4 A G 5: 48,419,210 probably null Het
Kif20a T C 18: 34,631,218 S666P probably benign Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Men1 A G 19: 6,335,858 Y133C probably damaging Het
Mtnr1a A G 8: 45,087,833 E277G possibly damaging Het
Numa1 C A 7: 101,998,948 Q629K probably damaging Het
Olfr437 T C 6: 43,167,411 S118P probably damaging Het
P3h3 G T 6: 124,854,933 D296E probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Tbx20 A G 9: 24,725,612 M393T probably benign Het
Upf2 A G 2: 5,957,652 D55G unknown Het
Vit G T 17: 78,619,657 V344L possibly damaging Het
Vps26a A C 10: 62,468,410 V176G possibly damaging Het
Other mutations in Gykl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Gykl1 APN 18 52694736 missense possibly damaging 0.94
IGL02694:Gykl1 APN 18 52694185 missense probably benign 0.00
R0689:Gykl1 UTSW 18 52694051 missense possibly damaging 0.90
R0908:Gykl1 UTSW 18 52695369 makesense probably null
R1428:Gykl1 UTSW 18 52694761 missense probably benign 0.00
R2229:Gykl1 UTSW 18 52695267 missense probably benign 0.00
R5307:Gykl1 UTSW 18 52694651 missense possibly damaging 0.67
R5696:Gykl1 UTSW 18 52694195 missense probably benign 0.02
R6278:Gykl1 UTSW 18 52695208 missense probably benign 0.06
R8804:Gykl1 UTSW 18 52694536 missense probably benign 0.00
RF040:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF041:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF042:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF044:Gykl1 UTSW 18 52694416 missense probably benign 0.06
Z1088:Gykl1 UTSW 18 52694165 nonsense probably null
Z1176:Gykl1 UTSW 18 52694547 missense probably damaging 1.00
Z1177:Gykl1 UTSW 18 52695132 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGTCGTTACGCCACATGGAAG -3'
(R):5'- ACTTGGTCACCACCAGCGAAAATG -3'

Sequencing Primer
(F):5'- TTACGCCACATGGAAGAAAGC -3'
(R):5'- CCAGCGAAAATGGTCAATATTTAAAG -3'
Posted On2013-11-08