Incidental Mutation 'R0942:Erich3'
ID82744
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission 039081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0942 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154739151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 518 (D518E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051862] [ENSMUST00000098496]
Predicted Effect unknown
Transcript: ENSMUST00000051862
AA Change: D321E
SMART Domains Protein: ENSMUSP00000062837
Gene: ENSMUSG00000078161
AA Change: D321E

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:DUF4590 102 217 9.8e-62 PFAM
low complexity region 299 327 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098496
AA Change: D518E
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: D518E

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172865
AA Change: D518E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133995
Gene: ENSMUSG00000042943
AA Change: D518E

DomainStartEndE-ValueType
Pfam:DUF4590 300 413 2.6e-58 PFAM
low complexity region 496 524 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
Aass C T 6: 23,075,152 probably benign Het
Abcb5 C A 12: 118,906,198 V742F possibly damaging Het
Abcd4 A G 12: 84,612,828 I165T probably damaging Het
Acer3 T C 7: 98,257,742 Y119C probably damaging Het
Ap3d1 A T 10: 80,732,955 probably benign Het
Ascc2 T A 11: 4,668,380 I325N probably benign Het
Atad2b T A 12: 5,024,591 I1050N probably damaging Het
Brms1l T C 12: 55,865,957 V245A probably benign Het
Cadps2 T A 6: 23,263,562 D1270V probably damaging Het
Cdh23 A T 10: 60,410,860 M936K possibly damaging Het
Cenpj A G 14: 56,555,209 probably benign Het
Dner T C 1: 84,585,309 probably benign Het
Dzip1 T A 14: 118,887,197 R555* probably null Het
Enpp4 A T 17: 44,101,881 L254* probably null Het
Gli2 G A 1: 118,837,506 R972C probably damaging Het
Gm5861 A T 5: 11,186,521 T174S probably benign Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Grb7 T C 11: 98,453,808 Y346H probably damaging Het
Heg1 T C 16: 33,760,803 L1192P probably damaging Het
Il16 T A 7: 83,663,141 Q445L probably benign Het
Il17d C T 14: 57,542,320 probably benign Het
Kmt2c A T 5: 25,315,303 N1936K probably benign Het
Lrrc45 T C 11: 120,718,238 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mphosph9 T A 5: 124,262,037 R934* probably null Het
Nek11 T A 9: 105,295,371 probably null Het
Nf1 T C 11: 79,438,711 S634P probably benign Het
Olfr293 T A 7: 86,664,106 M148K probably damaging Het
Pkhd1l1 T C 15: 44,532,959 V1959A probably benign Het
Pkp2 G T 16: 16,226,030 G216V probably benign Het
Ppp1r16a T C 15: 76,694,011 L394P probably damaging Het
Ptprc G A 1: 138,068,401 Q1070* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 A T 3: 95,765,418 I891N probably damaging Het
Taf15 T C 11: 83,499,106 I40T probably damaging Het
Tshz1 A G 18: 84,013,053 Y1077H probably damaging Het
Ttn T C 2: 76,863,489 E223G possibly damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7520:Erich3 UTSW 3 154763126 missense unknown
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
R7751:Erich3 UTSW 3 154763789 missense unknown
R7768:Erich3 UTSW 3 154748331 missense probably benign 0.00
R7955:Erich3 UTSW 3 154739314 nonsense probably null
R8001:Erich3 UTSW 3 154713916 missense probably benign 0.21
R8101:Erich3 UTSW 3 154733513 missense probably damaging 0.99
R8108:Erich3 UTSW 3 154720115 missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154764573 missense unknown
R8310:Erich3 UTSW 3 154704949 missense
Z1176:Erich3 UTSW 3 154698701 missense
Z1176:Erich3 UTSW 3 154762430 missense
Predicted Primers PCR Primer
(F):5'- CGGCTCTCAACATGCTATTCACAGG -3'
(R):5'- TTCGCTGTCCGAGCATCCAGTATC -3'

Sequencing Primer
(F):5'- GAAATATGACCTCACTGGGTCTC -3'
(R):5'- CGAGCATCCAGTATCCTCATTC -3'
Posted On2013-11-08