Incidental Mutation 'R0942:Ap3d1'
ID 82757
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Name adaptor-related protein complex 3, delta 1 subunit
Synonyms mBLVR1, Bolvr
MMRRC Submission 039081-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R0942 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80542790-80578098 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 80568789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
AlphaFold O54774
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,119,367 (GRCm39) noncoding transcript Het
Aass C T 6: 23,075,151 (GRCm39) probably benign Het
Abcb5 C A 12: 118,869,933 (GRCm39) V742F possibly damaging Het
Abcd4 A G 12: 84,659,602 (GRCm39) I165T probably damaging Het
Acer3 T C 7: 97,906,949 (GRCm39) Y119C probably damaging Het
Ascc2 T A 11: 4,618,380 (GRCm39) I325N probably benign Het
Atad2b T A 12: 5,074,591 (GRCm39) I1050N probably damaging Het
Brms1l T C 12: 55,912,742 (GRCm39) V245A probably benign Het
Cadps2 T A 6: 23,263,561 (GRCm39) D1270V probably damaging Het
Cdh23 A T 10: 60,246,639 (GRCm39) M936K possibly damaging Het
Cenpj A G 14: 56,792,666 (GRCm39) probably benign Het
Dner T C 1: 84,563,030 (GRCm39) probably benign Het
Dzip1 T A 14: 119,124,609 (GRCm39) R555* probably null Het
Enpp4 A T 17: 44,412,772 (GRCm39) L254* probably null Het
Erich3 T A 3: 154,444,788 (GRCm39) D518E probably benign Het
Gli2 G A 1: 118,765,236 (GRCm39) R972C probably damaging Het
Gpc1 G A 1: 92,785,031 (GRCm39) R358H possibly damaging Het
Grb7 T C 11: 98,344,634 (GRCm39) Y346H probably damaging Het
Heg1 T C 16: 33,581,173 (GRCm39) L1192P probably damaging Het
Il16 T A 7: 83,312,349 (GRCm39) Q445L probably benign Het
Il17d C T 14: 57,779,777 (GRCm39) probably benign Het
Kmt2c A T 5: 25,520,301 (GRCm39) N1936K probably benign Het
Lrrc45 T C 11: 120,609,064 (GRCm39) probably benign Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Mphosph9 T A 5: 124,400,100 (GRCm39) R934* probably null Het
Nek11 T A 9: 105,172,570 (GRCm39) probably null Het
Nf1 T C 11: 79,329,537 (GRCm39) S634P probably benign Het
Or14c40 T A 7: 86,313,314 (GRCm39) M148K probably damaging Het
Pkhd1l1 T C 15: 44,396,355 (GRCm39) V1959A probably benign Het
Pkp2 G T 16: 16,043,894 (GRCm39) G216V probably benign Het
Ppp1r16a T C 15: 76,578,211 (GRCm39) L394P probably damaging Het
Ptprc G A 1: 137,996,139 (GRCm39) Q1070* probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rprd2 A T 3: 95,672,730 (GRCm39) I891N probably damaging Het
Speer1e A T 5: 11,236,488 (GRCm39) T174S probably benign Het
Taf15 T C 11: 83,389,932 (GRCm39) I40T probably damaging Het
Tshz1 A G 18: 84,031,178 (GRCm39) Y1077H probably damaging Het
Ttn T C 2: 76,693,833 (GRCm39) E223G possibly damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80,577,813 (GRCm39) missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80,549,393 (GRCm39) missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80,554,993 (GRCm39) missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80,545,092 (GRCm39) nonsense probably null
IGL03404:Ap3d1 APN 10 80,565,871 (GRCm39) missense probably damaging 1.00
christian UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
Particle UTSW 10 80,546,328 (GRCm39) splice site probably null
vesicle UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80,559,449 (GRCm39) splice site probably benign
R0197:Ap3d1 UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80,563,812 (GRCm39) missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80,559,401 (GRCm39) missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80,555,075 (GRCm39) missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80,555,216 (GRCm39) nonsense probably null
R0792:Ap3d1 UTSW 10 80,544,313 (GRCm39) missense probably benign
R1015:Ap3d1 UTSW 10 80,552,323 (GRCm39) missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80,550,092 (GRCm39) missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80,568,674 (GRCm39) splice site probably benign
R1540:Ap3d1 UTSW 10 80,551,775 (GRCm39) missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80,565,844 (GRCm39) missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80,553,571 (GRCm39) nonsense probably null
R1669:Ap3d1 UTSW 10 80,546,670 (GRCm39) unclassified probably benign
R1839:Ap3d1 UTSW 10 80,562,942 (GRCm39) missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80,545,607 (GRCm39) missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80,568,770 (GRCm39) missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80,556,966 (GRCm39) missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80,549,832 (GRCm39) missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80,555,006 (GRCm39) nonsense probably null
R2849:Ap3d1 UTSW 10 80,577,742 (GRCm39) missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80,548,019 (GRCm39) missense probably benign
R4350:Ap3d1 UTSW 10 80,555,119 (GRCm39) missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80,555,646 (GRCm39) nonsense probably null
R4782:Ap3d1 UTSW 10 80,557,420 (GRCm39) splice site probably null
R4785:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R4834:Ap3d1 UTSW 10 80,555,560 (GRCm39) missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R5051:Ap3d1 UTSW 10 80,555,033 (GRCm39) missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80,545,284 (GRCm39) missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80,545,651 (GRCm39) missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80,563,001 (GRCm39) missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80,559,383 (GRCm39) missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80,554,964 (GRCm39) missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80,549,871 (GRCm39) missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80,546,298 (GRCm39) missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80,546,328 (GRCm39) splice site probably null
R6469:Ap3d1 UTSW 10 80,547,992 (GRCm39) missense probably benign
R6603:Ap3d1 UTSW 10 80,549,881 (GRCm39) missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80,550,156 (GRCm39) nonsense probably null
R6887:Ap3d1 UTSW 10 80,559,532 (GRCm39) missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80,577,767 (GRCm39) missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80,553,693 (GRCm39) missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80,559,637 (GRCm39) missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80,566,716 (GRCm39) missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80,577,734 (GRCm39) missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80,557,426 (GRCm39) missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80,558,755 (GRCm39) missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80,545,292 (GRCm39) missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80,553,678 (GRCm39) missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80,565,891 (GRCm39) missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80,550,135 (GRCm39) missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80,558,766 (GRCm39) nonsense probably null
R8314:Ap3d1 UTSW 10 80,559,373 (GRCm39) missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80,568,737 (GRCm39) missense probably damaging 1.00
R8896:Ap3d1 UTSW 10 80,552,425 (GRCm39) missense probably benign 0.01
R8936:Ap3d1 UTSW 10 80,547,952 (GRCm39) missense probably benign 0.02
R9183:Ap3d1 UTSW 10 80,545,627 (GRCm39) missense probably null 0.06
R9209:Ap3d1 UTSW 10 80,554,918 (GRCm39) missense probably benign 0.04
R9259:Ap3d1 UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R9476:Ap3d1 UTSW 10 80,545,655 (GRCm39) missense probably benign 0.00
R9645:Ap3d1 UTSW 10 80,545,062 (GRCm39) missense probably benign
R9664:Ap3d1 UTSW 10 80,548,639 (GRCm39) missense possibly damaging 0.71
R9781:Ap3d1 UTSW 10 80,545,609 (GRCm39) missense possibly damaging 0.51
X0019:Ap3d1 UTSW 10 80,554,936 (GRCm39) missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80,556,981 (GRCm39) missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80,555,071 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCAGGCAGGACTCTGCATGAACC -3'
(R):5'- GTCATCCAGAGCAGTAGCAGTCAC -3'

Sequencing Primer
(F):5'- CATGAACCTTGTGCTGCG -3'
(R):5'- AAGAGTCTCCTGTTACAGCCG -3'
Posted On 2013-11-08