Incidental Mutation 'R0942:Ap3d1'
ID82757
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 039081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0942 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 80732955 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
Aass C T 6: 23,075,152 probably benign Het
Abcb5 C A 12: 118,906,198 V742F possibly damaging Het
Abcd4 A G 12: 84,612,828 I165T probably damaging Het
Acer3 T C 7: 98,257,742 Y119C probably damaging Het
Ascc2 T A 11: 4,668,380 I325N probably benign Het
Atad2b T A 12: 5,024,591 I1050N probably damaging Het
Brms1l T C 12: 55,865,957 V245A probably benign Het
Cadps2 T A 6: 23,263,562 D1270V probably damaging Het
Cdh23 A T 10: 60,410,860 M936K possibly damaging Het
Cenpj A G 14: 56,555,209 probably benign Het
Dner T C 1: 84,585,309 probably benign Het
Dzip1 T A 14: 118,887,197 R555* probably null Het
Enpp4 A T 17: 44,101,881 L254* probably null Het
Erich3 T A 3: 154,739,151 D518E probably benign Het
Gli2 G A 1: 118,837,506 R972C probably damaging Het
Gm5861 A T 5: 11,186,521 T174S probably benign Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Grb7 T C 11: 98,453,808 Y346H probably damaging Het
Heg1 T C 16: 33,760,803 L1192P probably damaging Het
Il16 T A 7: 83,663,141 Q445L probably benign Het
Il17d C T 14: 57,542,320 probably benign Het
Kmt2c A T 5: 25,315,303 N1936K probably benign Het
Lrrc45 T C 11: 120,718,238 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mphosph9 T A 5: 124,262,037 R934* probably null Het
Nek11 T A 9: 105,295,371 probably null Het
Nf1 T C 11: 79,438,711 S634P probably benign Het
Olfr293 T A 7: 86,664,106 M148K probably damaging Het
Pkhd1l1 T C 15: 44,532,959 V1959A probably benign Het
Pkp2 G T 16: 16,226,030 G216V probably benign Het
Ppp1r16a T C 15: 76,694,011 L394P probably damaging Het
Ptprc G A 1: 138,068,401 Q1070* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 A T 3: 95,765,418 I891N probably damaging Het
Taf15 T C 11: 83,499,106 I40T probably damaging Het
Tshz1 A G 18: 84,013,053 Y1077H probably damaging Het
Ttn T C 2: 76,863,489 E223G possibly damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 splice site probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80709458 missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80730057 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80722932 nonsense probably null
R8314:Ap3d1 UTSW 10 80723539 missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80732903 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCAGGCAGGACTCTGCATGAACC -3'
(R):5'- GTCATCCAGAGCAGTAGCAGTCAC -3'

Sequencing Primer
(F):5'- CATGAACCTTGTGCTGCG -3'
(R):5'- AAGAGTCTCCTGTTACAGCCG -3'
Posted On2013-11-08