Incidental Mutation 'R0919:U2af2'
ID82776
Institutional Source Beutler Lab
Gene Symbol U2af2
Ensembl Gene ENSMUSG00000030435
Gene NameU2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Synonyms
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0919 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location5062143-5079938 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 5069434 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000165399] [ENSMUST00000207097] [ENSMUST00000209099]
Predicted Effect probably benign
Transcript: ENSMUST00000005041
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165399
SMART Domains Protein: ENSMUSP00000131458
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
RRM 8 63 3.31e0 SMART
low complexity region 78 93 N/A INTRINSIC
RRM 96 169 8.64e-19 SMART
RRM 209 294 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207097
Predicted Effect probably benign
Transcript: ENSMUST00000207498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208419
Predicted Effect probably benign
Transcript: ENSMUST00000209099
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Sash1 A G 10: 8,730,079 M849T probably benign Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in U2af2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:U2af2 APN 7 5067264 splice site probably benign
IGL02980:U2af2 UTSW 7 5068043 missense probably benign 0.37
R1768:U2af2 UTSW 7 5067545 missense probably benign 0.00
R2228:U2af2 UTSW 7 5075673 missense probably damaging 1.00
R2697:U2af2 UTSW 7 5067546 missense probably benign 0.00
R3974:U2af2 UTSW 7 5069439 splice site probably null
R5777:U2af2 UTSW 7 5066451 missense probably benign 0.37
R5916:U2af2 UTSW 7 5079180 critical splice acceptor site probably null
R6290:U2af2 UTSW 7 5075684 missense probably benign
R6860:U2af2 UTSW 7 5079274 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACTTTGCTACATTTGATAAACCAGCCCC -3'
(R):5'- TCAGAGTAGGCAGCACAGACCATC -3'

Sequencing Primer
(F):5'- cactctacttgttctgcctctc -3'
(R):5'- GACCATCCCTACTACCCCTTAC -3'
Posted On2013-11-08