Incidental Mutation 'R0919:Sash1'
ID82783
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 039069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0919 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8730079 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 849 (M849T)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: M849T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: M849T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,882,462 T124A probably benign Het
Alpk2 C A 18: 65,307,473 C283F probably benign Het
Anapc1 T C 2: 128,617,731 R1803G probably benign Het
Anapc4 T C 5: 52,855,637 V423A probably benign Het
Arfgef3 A G 10: 18,589,735 I2120T possibly damaging Het
Btaf1 T A 19: 36,990,743 H1109Q probably benign Het
Cfap70 G A 14: 20,404,164 P851S probably benign Het
Clcf1 T A 19: 4,222,198 L103Q probably damaging Het
Col11a2 T A 17: 34,059,150 V1032E possibly damaging Het
Cyp2c38 T G 19: 39,404,669 D318A probably benign Het
Dbpht2 A G 12: 74,299,000 noncoding transcript Het
Dhx34 A C 7: 16,201,958 V893G probably damaging Het
Fsip2 T A 2: 82,985,484 C3854S possibly damaging Het
Htr1a T C 13: 105,444,836 Y195H probably damaging Het
Insr A G 8: 3,158,769 S1231P probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kpna4 A T 3: 69,085,828 probably benign Het
Olfr1032 A G 2: 86,008,640 Y288C possibly damaging Het
Olfr607 A G 7: 103,460,812 I132T probably damaging Het
Olfr671 A T 7: 104,975,312 Y228* probably null Het
Osbpl7 G A 11: 97,056,101 R239H possibly damaging Het
Prkce G A 17: 86,630,160 V674I probably benign Het
Prkrip1 T C 5: 136,197,831 M52V possibly damaging Het
Scaf8 T C 17: 3,197,120 L906S probably damaging Het
Sfmbt2 T C 2: 10,577,571 L676P probably benign Het
Sgsm1 C T 5: 113,258,842 V923I probably damaging Het
Slc38a3 A T 9: 107,655,959 L305Q probably damaging Het
Slc44a5 A G 3: 154,243,586 Y232C probably damaging Het
Spag17 A T 3: 100,071,943 probably benign Het
Synm T C 7: 67,735,347 I414V probably damaging Het
Tbc1d12 C T 19: 38,914,049 H551Y possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Trpc7 C T 13: 56,822,649 probably benign Het
Trpm7 G A 2: 126,831,238 R532C probably damaging Het
Ttn T A 2: 76,946,742 K1485* probably null Het
Txn2 T C 15: 77,927,749 D69G probably damaging Het
U2af2 C T 7: 5,069,434 probably benign Het
Ubn1 T C 16: 5,064,391 Y239H probably damaging Het
Ubtf A G 11: 102,309,777 probably benign Het
Usp49 T A 17: 47,672,451 V127D probably benign Het
Washc2 C T 6: 116,208,264 R20W probably damaging Het
Zscan10 T C 17: 23,610,007 S476P probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACGGAGCCATCCAGTTTCTTAG -3'
(R):5'- AGTCTTTCACCAGGAGTCAGCCAG -3'

Sequencing Primer
(F):5'- GCCATCCAGTTTCTTAGCCATTG -3'
(R):5'- ACTGCCAAGAGCTGTGAC -3'
Posted On2013-11-08