Incidental Mutation 'R0919:Sash1'
ID 82783
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene Name SAM and SH3 domain containing 1
Synonyms A330076K04Rik, 2500002E12Rik, 1100001C18Rik
MMRRC Submission 039069-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0919 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 8597983-8761814 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8605843 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 849 (M849T)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: M849T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: M849T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C A 18: 65,440,544 (GRCm39) C283F probably benign Het
Anapc1 T C 2: 128,459,651 (GRCm39) R1803G probably benign Het
Anapc4 T C 5: 53,012,979 (GRCm39) V423A probably benign Het
Arfgef3 A G 10: 18,465,483 (GRCm39) I2120T possibly damaging Het
Btaf1 T A 19: 36,968,143 (GRCm39) H1109Q probably benign Het
Cfap418 A G 4: 10,882,462 (GRCm39) T124A probably benign Het
Cfap70 G A 14: 20,454,232 (GRCm39) P851S probably benign Het
Clcf1 T A 19: 4,272,252 (GRCm39) L103Q probably damaging Het
Col11a2 T A 17: 34,278,124 (GRCm39) V1032E possibly damaging Het
Cyp2c38 T G 19: 39,393,113 (GRCm39) D318A probably benign Het
Dbpht2 A G 12: 74,345,774 (GRCm39) noncoding transcript Het
Dhx34 A C 7: 15,935,883 (GRCm39) V893G probably damaging Het
Fsip2 T A 2: 82,815,828 (GRCm39) C3854S possibly damaging Het
Htr1a T C 13: 105,581,344 (GRCm39) Y195H probably damaging Het
Insr A G 8: 3,208,769 (GRCm39) S1231P probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kpna4 A T 3: 68,993,161 (GRCm39) probably benign Het
Or52d13 A G 7: 103,110,019 (GRCm39) I132T probably damaging Het
Or52e8 A T 7: 104,624,519 (GRCm39) Y228* probably null Het
Or5m3 A G 2: 85,838,984 (GRCm39) Y288C possibly damaging Het
Osbpl7 G A 11: 96,946,927 (GRCm39) R239H possibly damaging Het
Prkce G A 17: 86,937,588 (GRCm39) V674I probably benign Het
Prkrip1 T C 5: 136,226,685 (GRCm39) M52V possibly damaging Het
Scaf8 T C 17: 3,247,395 (GRCm39) L906S probably damaging Het
Sfmbt2 T C 2: 10,582,382 (GRCm39) L676P probably benign Het
Sgsm1 C T 5: 113,406,708 (GRCm39) V923I probably damaging Het
Slc38a3 A T 9: 107,533,158 (GRCm39) L305Q probably damaging Het
Slc44a5 A G 3: 153,949,223 (GRCm39) Y232C probably damaging Het
Spag17 A T 3: 99,979,259 (GRCm39) probably benign Het
Synm T C 7: 67,385,095 (GRCm39) I414V probably damaging Het
Tbc1d12 C T 19: 38,902,493 (GRCm39) H551Y possibly damaging Het
Timm21 G C 18: 84,967,387 (GRCm39) L130V probably damaging Het
Trpc7 C T 13: 56,970,462 (GRCm39) probably benign Het
Trpm7 G A 2: 126,673,158 (GRCm39) R532C probably damaging Het
Ttn T A 2: 76,777,086 (GRCm39) K1485* probably null Het
Txn2 T C 15: 77,811,949 (GRCm39) D69G probably damaging Het
U2af2 C T 7: 5,072,433 (GRCm39) probably benign Het
Ubn1 T C 16: 4,882,255 (GRCm39) Y239H probably damaging Het
Ubtf A G 11: 102,200,603 (GRCm39) probably benign Het
Usp49 T A 17: 47,983,376 (GRCm39) V127D probably benign Het
Washc2 C T 6: 116,185,225 (GRCm39) R20W probably damaging Het
Zscan10 T C 17: 23,828,981 (GRCm39) S476P probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8,627,177 (GRCm39) missense probably damaging 1.00
IGL01535:Sash1 APN 10 8,617,341 (GRCm39) missense probably damaging 1.00
IGL01537:Sash1 APN 10 8,605,422 (GRCm39) missense probably damaging 1.00
IGL01788:Sash1 APN 10 8,609,410 (GRCm39) missense probably benign 0.01
IGL01933:Sash1 APN 10 8,626,897 (GRCm39) missense probably damaging 0.99
IGL02126:Sash1 APN 10 8,615,229 (GRCm39) missense probably damaging 0.96
IGL02285:Sash1 APN 10 8,616,098 (GRCm39) missense probably damaging 0.99
IGL02400:Sash1 APN 10 8,609,411 (GRCm39) nonsense probably null
IGL02504:Sash1 APN 10 8,605,676 (GRCm39) missense probably benign 0.00
IGL02630:Sash1 APN 10 8,620,299 (GRCm39) missense probably benign 0.06
boyscout UTSW 10 8,618,186 (GRCm39) splice site probably null
cubscout UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R0592:Sash1 UTSW 10 8,605,546 (GRCm39) missense probably benign 0.00
R0647:Sash1 UTSW 10 8,605,316 (GRCm39) missense probably damaging 0.99
R0656:Sash1 UTSW 10 8,626,901 (GRCm39) critical splice donor site probably null
R0830:Sash1 UTSW 10 8,605,673 (GRCm39) missense probably benign 0.01
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1470:Sash1 UTSW 10 8,665,357 (GRCm39) missense probably damaging 1.00
R1606:Sash1 UTSW 10 8,605,721 (GRCm39) missense probably benign 0.00
R1707:Sash1 UTSW 10 8,606,141 (GRCm39) missense probably benign 0.00
R1922:Sash1 UTSW 10 8,603,672 (GRCm39) missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8,605,696 (GRCm39) missense probably benign
R1964:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R2013:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2014:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2015:Sash1 UTSW 10 8,605,177 (GRCm39) missense probably benign 0.03
R2074:Sash1 UTSW 10 8,632,461 (GRCm39) missense probably damaging 1.00
R2252:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2253:Sash1 UTSW 10 8,605,741 (GRCm39) missense probably benign 0.01
R2260:Sash1 UTSW 10 8,662,142 (GRCm39) nonsense probably null
R3085:Sash1 UTSW 10 8,618,186 (GRCm39) splice site probably null
R4024:Sash1 UTSW 10 8,605,681 (GRCm39) missense probably benign 0.00
R4039:Sash1 UTSW 10 8,605,391 (GRCm39) missense probably damaging 1.00
R4290:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8,606,006 (GRCm39) missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8,627,234 (GRCm39) missense probably benign 0.00
R4657:Sash1 UTSW 10 8,601,424 (GRCm39) missense probably damaging 1.00
R4669:Sash1 UTSW 10 8,606,149 (GRCm39) missense probably benign 0.00
R4719:Sash1 UTSW 10 8,605,477 (GRCm39) missense probably benign 0.01
R4745:Sash1 UTSW 10 8,605,672 (GRCm39) missense probably benign
R5197:Sash1 UTSW 10 8,615,989 (GRCm39) missense probably damaging 1.00
R5217:Sash1 UTSW 10 8,656,368 (GRCm39) missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8,621,950 (GRCm39) missense probably damaging 1.00
R5591:Sash1 UTSW 10 8,601,482 (GRCm39) missense probably benign 0.36
R6505:Sash1 UTSW 10 8,605,291 (GRCm39) missense probably benign 0.21
R6679:Sash1 UTSW 10 8,615,949 (GRCm39) missense probably damaging 1.00
R6761:Sash1 UTSW 10 8,620,286 (GRCm39) missense probably damaging 0.99
R6885:Sash1 UTSW 10 8,659,985 (GRCm39) missense probably damaging 1.00
R6980:Sash1 UTSW 10 8,605,612 (GRCm39) missense probably benign 0.00
R7034:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7036:Sash1 UTSW 10 8,605,847 (GRCm39) nonsense probably null
R7088:Sash1 UTSW 10 8,605,481 (GRCm39) nonsense probably null
R7289:Sash1 UTSW 10 8,605,960 (GRCm39) missense probably damaging 0.99
R7464:Sash1 UTSW 10 8,632,509 (GRCm39) missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8,605,155 (GRCm39) missense probably benign 0.01
R7752:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R7856:Sash1 UTSW 10 8,605,472 (GRCm39) missense probably benign 0.00
R7901:Sash1 UTSW 10 8,656,328 (GRCm39) nonsense probably null
R8152:Sash1 UTSW 10 8,626,805 (GRCm39) missense possibly damaging 0.94
R8218:Sash1 UTSW 10 8,627,000 (GRCm39) missense probably damaging 0.99
R8317:Sash1 UTSW 10 8,605,150 (GRCm39) missense possibly damaging 0.76
R8358:Sash1 UTSW 10 8,605,745 (GRCm39) missense probably benign
R8503:Sash1 UTSW 10 8,656,277 (GRCm39) splice site probably benign
R8696:Sash1 UTSW 10 8,609,459 (GRCm39) missense probably damaging 1.00
R8703:Sash1 UTSW 10 8,605,595 (GRCm39) missense probably damaging 0.99
R8710:Sash1 UTSW 10 8,656,285 (GRCm39) missense possibly damaging 0.82
R8822:Sash1 UTSW 10 8,761,615 (GRCm39) start gained probably benign
R8826:Sash1 UTSW 10 8,637,869 (GRCm39) start codon destroyed probably null
R8891:Sash1 UTSW 10 8,603,734 (GRCm39) missense probably damaging 1.00
R8968:Sash1 UTSW 10 8,606,179 (GRCm39) missense probably benign 0.00
R8984:Sash1 UTSW 10 8,626,808 (GRCm39) missense possibly damaging 0.46
R9194:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 0.99
R9248:Sash1 UTSW 10 8,617,296 (GRCm39) missense probably damaging 1.00
R9405:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9408:Sash1 UTSW 10 8,637,994 (GRCm39) start gained probably benign
R9489:Sash1 UTSW 10 8,605,169 (GRCm39) missense probably benign 0.05
R9576:Sash1 UTSW 10 8,620,299 (GRCm39) missense probably benign 0.06
R9632:Sash1 UTSW 10 8,615,969 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGGAGCCATCCAGTTTCTTAG -3'
(R):5'- AGTCTTTCACCAGGAGTCAGCCAG -3'

Sequencing Primer
(F):5'- GCCATCCAGTTTCTTAGCCATTG -3'
(R):5'- ACTGCCAAGAGCTGTGAC -3'
Posted On 2013-11-08